Please answer asap and in short and content should not be palgarised please Question 10What evidence led researchers to identity 18 codons in hemagglutinin gene as the important stes to assess when considering which flu vaccine to make for the next fu season?O The flu strains that had more silent mutations in these sites than replacement mutations were more lkely to be common in the futureO Using a phylogeny of fu strains, they found that the sequences of surviving flu strains had more replacement mutations at these sites than silent mutationsO They sequenced individuals that were dying each year of the flu, and found that mutations were not occurring at these 18 codon stesO They built a phylogeny of a series of fu strains and found that those that had survived were lacking these 18 codons

Name: Please answer asap and in short and content should not be palgarised p
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Please answer asap and in short and content should not be palgarised please Question 10What evidence led researchers to identity 18 codons in hemagglutinin gene as the important stes to assess when considering which flu vaccine to make for the next f

This question addresses the evidence that led researchers to identify 18 specific codons in the…

Science

Biology

Question 10 What evidence led researchers to identify 18 codons in hemagglutinin gene as the important sites to assess when considering which flu vaccine to make for the next flu season? O The fu strains that had more silent mutations in these sites than replacement mutations were more likely to be common in the future O Using a phylogeny of flu strains, they found that the sequences of surviving flu strains had more replacement mutations at these sites than silent mutations O They sequenced individuals that were dying each year of the flu, and found that mutations were not occurring at these 18 codon sites O They built a phylogeny of a series of thu strains and found that those that had survived were lacking these 18 codons

Question 10 What evidence led researchers to identify 18 codons in hemagglutinin gene as the important sites to assess when considering which flu vaccine to make for the next flu season? O The fu strains that had more silent mutations in these sites than replacement mutations were more likely to be common in the future O Using a phylogeny of flu strains, they found that the sequences of surviving flu strains had more replacement mutations at these sites than silent mutations O They sequenced individuals that were dying each year of the flu, and found that mutations were not occurring at these 18 codon sites O They built a phylogeny of a series of thu strains and found that those that had survived were lacking these 18 codons

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 4QP: Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods...

See similar textbooks

Similar questions

O O O OO HUAWEI nova 2 Plus DUAL CAMERA Question 56 In the CRISPR cas9 system, at which stage of the system the target gene double strand breaks? O a. Once the cas9 binds to single guide RNA Not yet answered O b. Once Single guide RNA bind to the PAM sequence.. Marked out of O C. Case9 binds to the PAM sequence. 1.00 Od. Cas9 binds to the gene of interest. P Flag question O e. Case9 binds to both single guide RNA and DNA. Question 57 In type, III CRISPR RNA processing and cleavage step the CRISPR RNA sequences are going to be composed of O a. Tracr RNA sequence only Not yet answered.. O b. Viral sequence and crRNA sequence Markèd out of C. Viral, crRNA and trascr RNA 1.00 O d. Viral sequence and CRISPR loop P Flag O e. Tracr DNA sequence question Question 58 DNA glycosylases are enzymes responsible for O, a. The detection of the damaged histones Not yet answered O b. The detection of damaged bases Marked out of O C. The detection of methylated nucleotides. 1.00 P Flag O d. The labeling…
Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune response against viral infection O a molecule involved in regulation of expression Oan enzyme complex involved in homologous recombination O bacterial conjugation system Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site consisting of an NGG sequence. Cas9 will mal
O All bacteria are naturally competent to undergo transformation under any condition. O A bacteria can only take up DNA from another living cell during transformation. Question 30 Which of these is NOT a correct statement about bacterial conjugation? O An F+ cell makes sex pili and attaches to an F- cell. O After conjugation between an Hfr and F- cell, the F- cell has a change in its chromosomal DNA O After conjugation between an F+ and F- cell, the F- cell has become F+. O After conjugation between an F+ and F- cell, the F+ cell has become F-. Question 31
QUESTION 14 What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence immediately downstream of your target site. What happens? O It's fine because you put the PAM sequence in your guide RNA O PAM sequences only apply to real viral infections, not CRISPR assays. O The Cas9 nuclease won't cut at the target site O The guide RNA won't be complementary to the target O They'll be more off target effects but it'll still work.
G where can Question 29 Not yet answered Points out of1.00 P Flag question When a gene is re-ordered on a chromosome, this is called example of this is the evolution of humans from chimpanzees. About 4,04 An https://www ribosom Palade, who Select one: eukaryotic c O a. Inversion People O b. Insertion Where can O c. Duplication Where are O d. Deletion Can riboso Where can Time left 0:55:56 Next pa DELL
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…
BICD100 HW6 Prokaryotic Genetics Question 1. You are interested in three genes in bacteriophage. The recessive mutant alleles cause plaque phenotypes that were creatively named fuzzy, shaky, and purple. Another lab published the following map of the three genes: fuzzy shaky 2.9 17.4 purple To verify the published map, you cross a purple shaky phage strain with a fuzzy phage strain by co- infecting E. coli at a high multiplicity of infection (every bacterium infected with both types of phage). You plate the resulting lysate and analyze the phenotypes of the plaques caused by the progeny phage. a. State the genotypes of the two parent phage strains: b. List all eight of the possible phenotypes that could result from this cross. If 400 phage plaques were examined from this cross, how many plaques of each of the eight phenotypic classes would you expect?
Which viruses have potential for the highest mutation rates? Explain RNA viruses as RNA polymerases do not proofread thus make many mistakes/mutations when viral RNA is copied RNA viruses as DNA polymerases do not proofread thus make many mistakes/mutations when viral DNA is copied O DNA viruses as DNA polymerases do not proofread thus make many mistakes/mutations when viral RNA is copied O DNA viruses as DNA polymerases do not proofread thus make many mistakes/mutations when viral DNA is copied
| Choose ) [ Choose] metagenomics whole-genome shotgun approach bioinformatics ed GenBank genomics
* ane cadon translates to one amino acid Mar.8.2021 *Ganes are partions of DiA *Genes cab for proten * Syntheso meon to make Something * Momliane tiansports, buidig musde, repOIring and immunty are all yobs.done by protein *DNA main pb isto nco ond cocde for profein * Jnly Eukoryotics hove DUA stored in the nucleus * Tronscaption o bacare translation. * Transcripton accur in the nudeus. contain genetic. * The Job.ok ycbo AlA Dolymerose. * RUA Polymerce2 is an Engyme, Enzynks gre a tye o protein *The 'm' in mouDA strands for messenger. * After beng oocted, MBWA leaves the nudeus to go to a cbasome *The fist in ihlA stond for Ribosomal * An Amino Hcid is a monomer f a piotein. * Ihe Jcb of a tRNA is to bring Onimo ocid so the protein be mode. * A Qadon s three booes toglther A ne Caon tronslates to one amino acid A Amino acid are hold boether by factde bond
y Cours S DIOE The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Kpn I Sall Eco RI Pst Bam HI Xho Bam HI Pst i Eco RI Kon I 100 200 300 400 500 B00 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 How many total restriction fragments will result if you complete digest the DNA fragment above with Sal I? cross out a. 1 cross out b. 2 cross out O c. 3 cross out d. 4 cross out e. 5 cross out O f. 6 cross out g. 7 cross out Oh. 8 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). t of Sal Eco RI Pat Xhol Bam HI Psti Eco RI Koni Kpn i Bam H