QUESTION 10 structures. Disulfide bridges can be formed by and helps in stabilizing O Cysteine; tertiary and quaternary Cysteine, primary, secondary, tertiary and quaternary Methionine; tertiary and quaternary Methionine; secondary, tertiary and quaternary

Q: 19. Label structure name only

A: We can say that The hypothalamus and the pituitary gland are part of the neuroendocrine system. The…

Q: What type of anatomical plane is marked "B" in the given figure? O frontal O coronal O transverse O…

A: There are mainly four types of anatomical planes. The first one is a frontal plane, the second is…

Q: ing to the video "Ben Goldacre: Battling Bad Science" from Assignment 5.2, which e statements is…

A: Placebo is a kind of substance which produces no medical effect. Placebo is given to create a  false…

Q: Question 5 of 10 Among the given statements, which one(s) is/are correct about alpha keratin? 1. It…

A: Alpha-keratin is a protein found in vertebrates. It is found in nails, hairs, claws and epidermis of…

Q: Name the class.

A: In a biological hierarchy, the class is a taxonomic level; that is, it is a taxonomic unit in that…

Q: Cuscutta is the example of................

A: Cuscuta is the native plant of America. However, it has spread to different parts of the world.

Q: 12. Identify the zwitterions in the list of substances (a) (CH3);NH(CH,);N_ (b)…

A: A zwitterion is a compound that contains both positive and negative charge areas in different…

Q: 0 || CH₂▬0—C—CH₂(CH₂) 13CH3 O || CH-O-C-CH₂(CH₂) 13CH3

A: The two fatty acyl chains are present in this molecule through ester bonds. These fatty acyl chains…

Q: Which of the following amino acids cannot be synthesized by the body? Select the correct…

A: Amino acids are the building blocks of proteins. Although, proteins are synthesized in the body, not…

Q: . What would be the consequence of an inactivating mutation in the HO gene in an a cell? [Select]

A: Inactivating mutation This mutation is also called as loss of function mutation. The product of this…

Q: Which is NOT an epimer of the monosaccharide below: CHO H- OH H- HO. CH,OH

A: An epimer is one of the two or more stereoisomers of the same molecule that differ in the position…

Q: 28l. Collagen formation needs Vitamin C toproline to   reduce, pyrolidine carbaldehyde reduce,…

A: Option d Oxidize, hydroxyproline Hydroxylation is the most common oxidation reaction on CMs.

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: Why Ranitidine is better than Cemitidine? Please explain at your own words.

A: There are several drugs used to treat peptic ulcer disease. Peptic ulcer is characterized by…

Q: Tina needs 2800 calories a day to support her energy needs during training. She tends to focus more…

A: Introduction Nutrition:- It is the process of taking in food and converting it into energy for…

Q: #21: Name the entire structure indicated by the bracket. #21

A: Plants have specialized tissues for the transportation of substances across different parts of the…

Q: Identify the structure.

A: The bone provided in the figure is the ethmoid bone. The ethmoid bone is one of the eight bones that…

Q: Identify the highlighted fiber.

A: the highlighted fiber are :

Q: The arrangement of muscles so that the action of one muscle is opposite to that of its partner is: O…

A: Please follow step 2 for detailed explanation.

Q: Henrik is building a terrace with a wooden trolley and uses a powerful cutting / miter saw. He has…

A: The bean-shaped organs which lie in the abdominal cavity, have a reddish appearance and function to…

Q: 11 Endocrine glands are often called "ductless glands" because their products are secreted directly…

A: Endocrine glands secrete hormones. Hormones are secreted from one gland and activates the functions…

Q: 4 6、そー 25a

A: Bony skeleton provides points of attachment for skeletal muscles. The skeletal muscles contract to…

Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: IDENTIFY THE FOLLOWING PARTS  A  B  C  D  E  F  G  H  I  J

A: The cell is the basic and functional unit of life. It is composed of various cell organelles.

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: i am studying for my first test and a question came up that i cant make sense of. the question is…

A: The IVDs are intervertebral discs present between adjacently located vertebrae in the spinal column.…

Q: Anyone know these three Blood. Cells?

A: White blood cells (leukocytes) don't have a well-defined shape because their shape is continually…

Q: #8: What is the function of the entire indicated structure?

A: Most of the stomata are positioned in the lower epidermis while the cells of the lower epidermis…

Q: Identify the amino acid(s) present in this structure. isoleucine Ophenylalanine valine cysteine…

A: The molecule in question is a dipeptide i.e. 2 amino acids joined together via a peptide bond. In a…

Q: 10.12 2. What is the clinical significance of ALT?

A: Alanine aminotransferase, or ALT, is an enzyme that is mostly found in the liver. ALT's purpose is…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH…

A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…

Q: [Sand dollar] Aboral surface Oral surface Figure 20:

A: It is a sand dollar (marine echinoderm) which is buried in sand at the deep bottom of the ocean.

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingosine is composed of  an amino alcohol head group, with two hydroxyls, and one amino group…

Q: 4. G's go with A's T's C's G's

A: Nucleic acid such as RNA or DNA is composed of several nucleotides joined end to end A nucleotide is…

Q: anterior drawer sign. An MRI shows injury to several structures of the knee, including her medial…

A: Injuries occurring due to lateral blue to the knees can be tears in the lateral collateral ligament.…

Q: There are only two things to remember.  Number One... Don't Stop, and Number Two... Keep Going!”…

A: Frank Zappa's advice encapsulates the essence of perseverance and resilience. It reminds us that…

Q: Making a Muscle Activity 1. Separate a twizzler by pulling apart the strands. Each strand will…

A: A muscle attaches to a bone through a tendon.  A muscle fiber is covered by a layer of connective…

Q: Iron

A: Introduction Protein is the most abundant macromolecule in our body. Protein is made up of amino…

Q: 5

A: Endocrine glands secrete chemical substances directly into the blood. They don't secrete their…

Q: 7 1 2 3 10 [No Titie) | 11 12 13 14

A: Gray and white matter make up the spinal cord. The grey matter is found inside the spinal cord and…

Q: #5: What is the function of the dark red, crescent- shaped tissue at the tip of the pointer?

A: With the advancement in microscopy, the world at the microscopic level was studied in depth. The…

Q: 3 things you need for a muscle to contract

A: The intricate physiological process of muscle contraction enables us to move our bodies and carry…

Q: Which drug is NOT lipid based?   prednisone warfarin erythromycin aspirin lovastatin

A: Asked : Drug which is not lipid based.