Put the following steps of transcription in order 1. RNA polymerase enzyme attaches to DNA at the site of a gene.T 2. The enzyme unzips the DNA.3. The MRNA leaves the nucleus through a nuclear pore.4. The enzyme reads the code on the DNA.15. A strand of mRNA is created that is a copy of the gene.6. The ribosome reads the mRNA strand.47. The enzyme attached complementary RNA nucleotides, following the base-pair rules.Next Page

Name: Put the following steps of transcription in order 1. RNA polymerase en
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Put the following steps of transcription in order 1. RNA polymerase enzyme attaches to DNA at the site of a gene.T 2. The enzyme unzips the DNA.3. The MRNA leaves the nucleus through a nuclear pore.4. The enzyme reads the code on the DNA.15. A strand

The Central Dogma Theory is one of the most important concepts in the field of Cell Biology. It…

Answered: Put the following steps of…

Science

Biology

Put the following steps of transcription in order

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 9SA: Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from...

See similar textbooks

Similar questions

Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ________. a. the nucleotide b. DNA polymerase c. phosphate-group transfers from ATP
1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
Match Column A (Description) with Column B (protein/enzyme). unwinds the double helix of DNA in replication makes a short section of RNA to act as a primer links separate stretches of DNA stabilizes the unwinding of the helix relieves the tension in the double stranded DNA (dsDNA) facilitate the switching on of genes…
Below is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes MRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Promoter MRNA RNA TRNA region polymerase
1) Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the complementary base pairs for a single strand of DNA.
8. Below is a double stranded DNA: ATATGTGGTCTCGG TCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the MRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the MRNA transcript. 8.2. 8.3. Identify the polypeptide chain below it. Align the MRNA and polypeptide so that it is clear which DNA bases they came from.
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…
8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNA
Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
Below is a list of functions related to protein synthesis. Place the number for the function in the blank above its corresponding structure. 1. Copies the genetic code from DNA and carries it to the ribosomes 2. Splits DNA into two strands and transcribes mRNA from the antisense strand 3. Carries amino acids to the ribosome 4. Area on DNA antisense strand that RNA polymerase binds to begin transcription Answer Answer Answer Answer Promoter region mRNA RNA polymerase tRNA