Psoriasis, a skin lesion, is characterized by

Q: Monoglycerides are made of glycerol and __________

A: Monoglycerides are a type of fat naturally found in many foods. They can be either saturated or…

Q: Chiral / achiral * HO. Achiral Chiral

A: Asked : If given carbon is chiral or not Given : CH3-CH2-CH(CH3)-CH2OH Marked carbon is to be…

Q: Can you please help me how to draw tripeptide ile-leu-arg and indicate the torsion angles phi and…

A: Amino acids are organic acids that contain both carboxylic acid group as well as amine groups. The…

Q: The Primary Structure of a Protein Is Its Linear Arrangement of _____________

A: . The primary structure of the protein is linear, and covalent peptide bonds are present between…

Q: If the fifth Fibonacci number is 5, calculate the value of the 14th Fibonacci number. 144 233 377…

A: The objective of the question is to find the 14th Fibonacci number given that the 5th Fibonacci…

Q: Multisubunit proteins in which some or all of the subunitsare identical are referred to as…

A: Multisubunit proteins are considered as those proteins, which are composed of more than one protein.…

Q: are nitrogen bases with two rings.

A: Nitrogen bases are an integral part of a nucleotide from which the DNA is made. Apart from nitrogen…

Q: 168cm and 57kg. What is the BMI?

A: The BMI is defined as the body mass index of a person and is found by dividing a person's weight in…

Q: All _____________ Proteins and _________ Are Asymmetrically Oriented in the Bilayer

A: A cell membrane or biological membrane is a selectively permeable membrane that is responsible for…

Q: element responsible for the distinct odor of thiols and thioether

A: Thiols give off strong, unpleasant odors resembling that of garlic or rotten eggs hence are used as…

Q: Chemical formula of Nucleotides

A: The nucleic acids are formed from monomers called nucleotides. There are four nucleotides in DNA,…

Q: Having been carried from adipose tissue in the bloodstream, fatty acids are taken into muscle by…

A: Answer : such as albumin and triacylglycerols. Reason : Fatty acids are either complexed with…

Q: The solid black line represents the backbone of the protein. Functional groups 1 and 2 are [ Select]…

A: Q. The solid black line represents the backbone of the protein. Functional groups 1 and 2 are    •…

Q: The manner in which nuclei acids join together forms a _______________ - _____________ backbone

A: Nucleic acids are of two types- RNA- Ribonucleic acid. DNA- Deoxyribonucleic acid.

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: Diglycerides are made of glycerol and __________

A: Diglycerides are a form of glycerides that are involved in biochemical signaling. These molecules…

Q: Sequence of Carminic acid

A: Carminic acid is a type of red dye that is extracted from various insect taxa like- Kermes vermilio,…

Q: Draw (-)-alanine and (+)-alanine, using the Fischer projection for both.

A: Alanine is an aliphatic amino acid. A fischer projection is used to represent a 3-D molecule drawn…

Q: _____________ are nonsuperimposable, non-mirror-image stereoisomers.

A: Stereoisomerism is considered as the spatial arrangement of the atoms which differs in isomers.

Q: Triglycerides are made of glycerol and _________

A: Triglycerides are the one of an important group of naturally occurring lipids which is otherwise…

Q: The protein components of lipoproteins are called _____________.

A: The protein components of lipoproteins are called Apolipoproteins.

Q: What exactly is the significance of the abbreviation DFR?

A: Introduction  Enzymes are proteins that catalyze or speed up chemical reactions in living organisms.…

Q: how did you detremine the ln(2)?

A: The concept of 'ln' is nothing but simple mathematics. We can simply type - 'ln 2' in a calculator…

Q: The amide linkages of proteins are referred to as________________________.

A: Introduction: Proteins are major biomolecules that consist of long chains of amino acids. The…

Q: Mechanism of action and effects of Zuclopenthixol with diagrammatic representation.

A: Zuclopenthixol is an antipsychotic medication which is  indicated for the management of…

Q: Sometimes the _______________ groups of proteins release hydrogen ions.

A: Proper functioning of body depends on a proper balance between acid and base concentration in the…

Q: Which is NOT an epimer of the monosaccharide below: CHO H- H- HO- H- ČH,OH CHOICES:

A: Option CAT is not epimer of monosaccharide shown in the question.  Epimer: in which only one sugar…

Q: are small proteins produced by cells infected with a virus, and sometimes can be used in viral…

A: If a person is virally infected, the infected cells starts to produce small proteins known as…

Q: _____________ compounds exclude water.

A: Rule of thumb that states that "like dissolves like" which means that polar molecules are dissolved…

Q: Urea synthesis begins with the formation of _____________.

A: The urea cycle is a biochemical process that converts the toxic substance  (ammonia) which was…

Q: Hemoglobin is 6.0% heme (C₃₄H₃₂FeN₄O₄) by mass. Toremove the heme, hemoglobin is treated with acetic…

A: Hemoglobin (Hb) is the iron containing oxygen transport metallo-protein in the red blood cells or…

Q: Find the connection among the words below and choose the letter of the word which is different. O A.…

A: DNA fragment separation is accomplished using the agarose gel electrophoresis technique. It…

Q: 8 sources of monosaccharaides

A: Ans: Monosaccharaides: The simple form of sugars which only has one oxygen as well as two hydrogen…

Q: When a purine or a pyrimidine is linked through a β-N-glycosidic link to C-1 of a pentose, the…

A: Nucleic acids are the biomolecules that contain Deoxyribose sugar (DNA) and ribose sugar (RNA) .both…

Q: Physiological Significance of all amino acids

A: Solution Aspartate - in urea cycle, aspartate and ammonia donate amino groups leading to formation…

Q: If the fifth Fibonacci number is 5, calculate the value of the 14th Fibonacci number. 144 233 377…

A: The objective of the question is to find the 14th Fibonacci number. The Fibonacci sequence is a…

Q: 3. blood vessel labeled 2 is called

A: Frog ( Rana catesbeianus) basically an amphibians which inhabits in both aquatic and terrestrial…

Q: Name plz

A: Stomach, a part of alimentary canal receives food from the esophagus. It Secretes digestive juices…