Q: The maximum photosynthetic rate of a sun leaf is higher or lower than a shade leaf? Higher No answer…
A: Photosynthesis is the conversion of light energy by phototrophs into chemical energy, which is then…
Q: What are the risk factors for male breast cancer?
A: Breast cancer in men is a rare cancer that occurs in men's breast tissue. Men can develop breast…
Q: 8. Water regulation Describe how the body regulates water. In your answer include: the name of the…
A: The balance between water intake and excretion is necessary for homeostasis. The majority of water…
Q: A. Observe the frog ovary and take note of the following structures: theca interna, theca externa…
A: Ovary This is a reproductive hormone where eggs are formed. There are a pair of ovaries present in…
Q: ARVCS is a disorder characterized by the replacement of healthy heart tissue with fatty fibrous…
A: Mutation is any change in the nucleotide sequence of the gene. It may lead to disorders if it makes…
Q: There is no such thing as truly direct evidence in evolution. Because of the long time spans, we can…
A: Evolution can be defined as a process in which modification of characteristics of organisms takes…
Q: Match the number from the key below to each of the following processes, in order: chemiosmosis;…
A: Q.Match the number from the key below to each of the following processes, in order: chemiosmosis;…
Q: 4. Use what you know about the anatomy and physiology of special sensory organs to evaluate how each…
A: we will be discussing how different changes in an animal's anatomy and physiology can impact its…
Q: What role do hydrogen bonds play in nucleic acid and protien syntheis
A: Although hydrogen bonds are weak covalent connections, they are crucial to the three-dimensional…
Q: 3. Explain why the specimen must be centered in the field of view on low power before going to high…
A: Microscopy is the technical field of using microscopes to view objects and areas of objects that the…
Q: Name the two functional divisions of the vertebrate nervoussystem, and describe how they interact.
A: Introduction The nervous system is the main controlling center of the body which controls all…
Q: Name the four essential elements in cell communication.
A: Introduction Cell signaling is the process in which different cells in the body of an organism…
Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…
A: A subfield of biology called cell biology examines the composition, operation, and behaviour of…
Q: (MRI device) 1. What are the ingredients? The device? 2. The working principle 3. What common…
A: MRI also known as Magnetic Resonance Imaging. It is a medical imaging techniques .
Q: Explain the following areas about scan)) ((Computed tomography..CT 1. What are the ingredients the…
A: A computed tomography scan is a type of medical imaging procedure used to produce in-depth pictures…
Q: II. QUESTIONS FOR RESEARCH. Make sure to provide your references. Use CBE or APA format. A. Make a…
A: Introduction The amphibia ovary, which contains six or more central, hollow sacs that give it a…
Q: The table below shows short DNA sequences from a gene in a closely related group of dragons, as well…
A: We have a group of seven closely related dragon species with homologous gene sequences. These are…
Q: Genotype frequencies from two diploid populations are estimated from a genetic marker with two…
A: Inbreeding In biology, inbreeding means reproduction from closely related individual.
Q: Which of the following accurately represents proper genotypes for a dihybrid cross? Group of answer…
A: These options represent different types of crosses. In genetics on the basis of the characters or…
Q: Despite CAM photosynthesis having a comparatively higher water use efficiency relative to C3 and C4…
A: CAM pathway is adapted in plants to perform photosynthesis under stress. The CAM pathway reduces…
Q: Why do electron microscopes have a better resolution versus light microscopes? OA. The additional…
A: Introduction: A method for getting high resolution photographs of both biological and non-biological…
Q: QUESTION 6 In bryophytes, the gametophyte is O the dominant generation O dependent on the sporophyte…
A: Bryophytes are plants placed under Phylum Bryophyta. Bryophytes lack true stems, leaves, or roots.…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: Part III - Trait Analysis 1. The following pedigrees will be used to determine whether the trait is…
A: Pedigree is a family chart showing the Inheritance of a particular trait through several generations…
Q: Why is a theory more comprehensive than a conclusion?
A: Introduction Scientific method is the process of systematizing and extending the understanding of…
Q: Define atomic number, atomic weight, and isotope
A: Atomic number, Atomic weight, and isotope are terms that are related to chemistry. All this…
Q: Explain the factors that affect the validity of experimental data (controls, bias, correlation,…
A: The validity of an experiment is a measure of how accurate the results are.
Q: What level of protein structure is hexameric insulin?
A: The pancreas has a very important role in the body. It can function as endocrine as well as…
Q: Name the major organ systems, and describe thegeneral functions of each.
A: Introduction: There are a lot of cells in the human body. Tissues are a specific class of cells that…
Q: How does an enzyme affect a chemical reaction?
A: In living organisms many chemical reactions take place. It occurs in physiological activities.…
Q: The picture shows the different stages in the life of a pea plant. Which characteristic of living…
A: Introduction A plant is a living organism of the type represented by trees, shrubs, herbs, grasses,…
Q: Which of these discoveries were used by paleontologists to conclude that some hominins—Homo erectus,…
A: The species H. erectus is extremely diverse, which is not surprising given its long existence and…
Q: Which statement is true? Explain your answer. A. Natural selection acts on populations, not on…
A: Introduction Natural selection is an evolutionary process by which the organisms that can adapt to…
Q: According to the graphical theory of life history evolution, describe the shape of the trade-off…
A: A group of creatures that can breed with one another in nature and create healthy offspring is…
Q: Animals in the phylum Mollusca exhibit (choose the correct answer) Question 7 options:…
A: The phylum Mollusca is the second-largest animal phylum. The molluscs include many familiar animals,…
Q: Bacteria are _in comparison to eukaryotic cells.
A: Introduction The cells are the fundamental units of all living things. There are billions of cells…
Q: hy is the Baermann-Moraes method suitable for a suspect strongyloidiasis? Why is it considered a…
A: Strongyloidiasis is a disease caused the nematode Strongyloides stercoralis. It is believed to…
Q: Briefly discuss the relationship between leukaemia and lymphoma.
A: Leukemia is a blood cancer. It is a cancer of blood-forming tissue that leads to a decrease in the…
Q: By what mode of cell division would you expect sperm cells to be formed in the haploid male be?…
A: Introduction: The process of sperm cell formation is called spermatogenesis. To create spermatozoa,…
Q: Please help me understand this question
A: Introduction Biomolecules are generally found in the complex form such as in the polymer stage even…
Q: Explain why a complete atom is electricallyneutral.
A: An atom is the smallest unit of body organisation. Several atoms get united to form molecules and…
Q: The scientific method is a set of techniques for gaining new knowledge about the world in which we…
A: The scientific method is a set of techniques for gaining new knowledge about the world in which we…
Q: Which of the following pairs correctly describes an example of antagonistic hormones that regulate…
A: Introduction The institution of glands that secrete chemical currier (hormones) is the endocrine…
Q: What is the cause of male gynecomastia?
A: Introduction Hormones play important role in normal physiology in our body. They control various…
Q: The tetrapeptide Cys-Trp-Lys-Pro was digested with chymotrypsin and adjusted to pH=0.5 to fully…
A: Each protein or peptide is made up of a linear sequence of amino acids. The primary structure of a…
Q: What has been successful in previous attempts for weight loss?
A: Being overweight has an adverse impact on the health of a person as it can invite various diseases…
Q: You should always position the cells or tissues in the center of view before increasing…
A: It is important to position the cells or tissues in the centre while viewing under a microscope…
Q: Despite CAM photosynthesis having a comparatively higher water use efficiency relative to C3 and C4…
A: Photosynthesis is a process by which plant produce their food ( form of glucose) using the sunlight,…
Q: What is the most common cause of liver cancer?
A: A tumour that can develop anywhere in the liver is called liver cancer. On the top right side of…
Q: Other than bacteria list the other 6 types of Microorganisms
A: Introduction The word microorganism is derived from two words "micro" meaning "small" (10-6) and…
Provide two reasons why marine habitat classification is useful to marine scientists.
Step by step
Solved in 2 steps
- Answer the following questuons below: 2.) How is light important to the organisms of the lower intertidal zone? 3.) What other physical factors contribute to the diversity in the intertidal zone? List two and explain how these affects the species found in the intertidal.The authors of the article state that the physical and chemical environment of marine habitats can affect all of the following, except: a:structure of communities. b:calcification rates. c:species ranges. d:aggressiveness of invasive species. article reference: https://www.frontiersin.org/articles/10.3389/fmars.2023.1075228/full the link for the article is all i could include but ill post the name of the article as well. Responses of intertidal invertebrates to rising sea surface temperatures in the southeastern Indian Ocean by Fred E. WellsINTRODUCTION: Quadrat sampling is a classic tool for the study of ecology, especially biodiversity. In general, a series of squares (quadrats) of a set size are placed in a habitat of interest and the species within those quadrats are identified and recorded. QUESTION: What are the advantages and disadvantages of a quadrat sampling method?
- As all ecosystems are connected, in the warming sea temperature, what techniques are used to create stream. Attach the website link for reference.Briefly describe the following aquatic ecosystems:Freshwater - Coral Reefs & Estuaries - Open Ocean -Describe the conditions and challenges facing organisms living in the intertidal zone.
- Identify the limiting factors that play important roles for various communities of marine organisms (from the deep sea to the intertidal zone and from the tropics to polar regions) and for various communities of nonmarine organisms (from lowland equatorial regions to mountaintops and polar regions). How do the compositions of various communities reflect the presence of the limiting factors? Use the shown Visual Overview as a guide.Briefly describe one similarity between the way large lakes and the marine environment are divided up into horizontal and or vertical zones. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA O wordsWhat do you think happens to this plastic? List a few examples of plastic impacting ocean ecosystems and provide links to your sources. answer
- Describe three kinds of benthic marine communities that use hard sub-strates and three that use soft substrates. What are the main physical factors that separate community types within each substrate category?What are the similarities and differences between conservation bio from preservationism? create venn diagramANSWER THE FOLLOWING: If you are to engage into aquaculture, how will you do it considering your current location and available resources. What species, level of management and culture system will you consider? (imagine your location is Philippines) On the otherhand, if all resources are available and favorable, what brackishwater and marine species will you grow/culture? Discuss your criteria of considering these species. Describe the level of management and culture system that you will employ.