Q: Which of the following - if it had occurred - would have resulted in the myxoma virus in Australia…
A: Introduction Myxoma virus is a poxvirus in the genus Leporipoxvirus. Myxomatosis is caused by the…
Q: How does the Red Queen hypothesis affect coevolution between host species and parasites?
A: Introduction A parasite is an organism that lives on or in its host and feeds on or at the expense…
Q: Pyruvate from glycolysis is oxidized by ATP. in the mitochondrial matrix. a. b. to release water. C.…
A: Aerobic respiration :- it is the process of cellular respiration that takes place in presence of…
Q: 1.Fatigue is caused because of formation and depositing of which among the following acids in…
A: Introduction Fatigue:- It is a term used to describe an overall feeling of tiredness or lack of…
Q: Lantus differs from "normal" insulin in that: Select one: Oa. The usual insulin molecule has been…
A: Glucose is the monosaccharide sugar which is a major energy source for the cells to function.…
Q: INDICATOR FOR EVALUATION OF EFFICIENCY OF WORK OF VENTILATION OF PREMISES OF RESIDENTIAL AND PUBLIC…
A: Answer is.. the content of harmful substances in the air.
Q: Describe the way turfgrasses grow. What has influenced their evolution and whatimplications does…
A: Evolution is the change in characteristics of a species over a large period of time over its…
Q: THE MAIN INDICATOR OF ERIDEMIOLOGICAL RELIABILITY IN WATER DISINFECTION IN WATER SUPPLY STATION (AT…
A: The disinfectants are mainly used to eliminate the various bacteria or microorganisms which causes…
Q: Can you explain which answer is accurate and why it's the correct choice?
A: The bottleneck effect describes how a population's size is reduced and then increased, affecting the…
Q: 7. A nail driven into the side of a tree will remain at exactly the same distance from the ground…
A: Angiosperms: Flowering plants, also known as angiosperms, are plants that produce flowers and…
Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…
A: Appendectomy is a major surgical procedure to remove appendix during an urgent condition to treat…
Q: define both selective and enrichment media as they may be used in clinical microbiology
A: Media in microbiology or also known as bacterial culture media. It is a growth medium used to grow…
Q: 0.0 1.0 0.0 3 0.0 0.0 1.0 4 0.5 0.25 0.25 5 0.25 0.25 0.5 0.25 0.5 0.25 7 0.33 0.33 0.33 8 0.04 0.32…
A: According to Hardy Weinberg equilibrium- p2+q2+2pq=1 Where, p= frequency of the dominant allele in…
Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…
A: Please follow step 2 for detailed explanation.
Q: How does the blood in the pulmocutaneous arch differ from that in the higher two aortic arches?
A: The circulatory system of amphibians includes pulmocutaneous circulation. It is in charge of…
Q: To explain: How the loss of AP3 causes a defect in melanosomes.
A: Pigment is a material that changes the colour of transmitted light due to selective wavelength…
Q: the ATP/ADP ratio in the cell is high, the CAC stalls and citrate is diverted to the synthesis of…
A: There are few important points about mitochondria : As we know that mitochondria are energy…
Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…
A: Forensic analysis using DNA samples The DNA sequences can be a helpful tool to determine the…
Q: cance of color blindness in humans is due to a recessive gene located on the X chromosome X linked).…
A: Mother × father XXc XcY Progeny - X Xc Xc XXc…
Q: ewith a long tailed mouse. Multiple cresses of this short-tailed mouse to long-taled mice produces…
A: Genotype can be refer to a gene or set of genes that leads to a single trait or disease.
Q: 1. What are the major adaptations that allow nemertines to thrive in the marine environment? Support…
A: Adaptation: It is a process of evolution that allows any particular organism to be well suited for…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: INDICATOR INDIRECTLY INDICATING FOR LONG WATER POLLUTION BY HOUSEHOLD-CONSUMER WASTE WATERS 1.…
A: Chemical contamination of water sources causes water to become unsafe for consumption, cooking,…
Q: The addition of monomeric units to one end of a polymer and their removal from the opposite end such…
A: Introduction The cytoskeleton of a cell is made up of intermediate filaments. actin filaments and…
Q: Which of the following examples DOES NOT involve negative feedback regulation? Regulation of…
A: Introduction The tendency to retain a generally constant internal condition, amid alterations in the…
Q: Explain in 3 paragraphs Charle’s Darwin Theory of Descent Modification
A: Years and years of Evolution have led to the world that we live in right now. Evolution refers to…
Q: Why is aseptic urine collection important when cultures are ordered? If you counted 20 colonies…
A: Urine collection for the urinary tract infection.
Q: Define the following terms: a. Chermolithoheterotroph b. Microaerophile c. Chermoorganoheterotroph…
A: The living world, as we all know it, can predominantly be divided into - Plants and Animals. Apart…
Q: discoideum) occasionally aggregate into a colony. About 20 percent of the amoebae in the colony make…
A: Kin selection favors the reproductive success of the other relatives even at a cost to the…
Q: Many modern people have some Neanderthal DNAin their genome, but the Neanderthal alleles are…
A: In the last 100,000 years, Neanderthals and contemporary humans have interbred at least twice. It is…
Q: What information does the Shannon index provide? What different factors should you consider before…
A: The Shannon diversity index calculator is a tool that may be used to estimate species diversity in a…
Q: majority of cancers in human are due to mutations in the p53 gene, however, cancers that are caused…
A: P 53 protein is also known as the tumor suppressor protein which is a type of phosphoprotein edit…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…
A:
Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…
A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…
Q: similarities and differences of nervous system and endocrine system
A: Organ system: The biological system consisting of a group of organs that work together to perform…
Q: To explain: How the low pH of lysosomes protect the rest of the cell from lysosomal enzymes in case…
A: Many metabolic pathways exist in the human body to maintain homeostasis. Many chemical reactions…
Q: 43) Topic of Lipids A second big category of lipids are isoprenoids. What are three precursors to…
A: Isoprenoids are a broad class of natural products commonly found in plants and other living beings.…
Q: To explain: How would an uncoupler Dinitrophenol of oxidative phosphorylation promote weight loss.
A: The organic chemical compound 2,4-dinitrophenol (DNP) It is a biochemically active chemical that…
Q: ROSE OF WIND 1. graphic image of the frequency of wind direction in the area 2. wind speed, shown…
A: A wind rose is a graphical tool that meteorologists employ to show how wind speed and direction are…
Q: If a plant’s stomata are made to stay open at all times, orclosed at all times, it will die. Why?
A: Stomata are the tiny holes which are present on the surface of the leaves. The function of the…
Q: Genotypic Ratio: Phenotypes: Phenotypic Ratio: Rr Genotypes. Genotypic Ratio: Phenotypes: Phenotypic…
A: In order to explain the inheritance pattern Mendel gave three laws -law of dominance, law of…
Q: With the aid of a diagram describe how the human body responds to exposure to the flu virus.
A: Lymphocytes, a type of white blood cell found largely in 'lymphoid tissues' such as the lymph nodes…
Q: Describe briefly the Trp operon? Why is it considered an example of negative regulation?
A: An operon is a cluster of genes that are transcribed together to give a single messenger RNA (mRNA)…
Q: THE MAIN INDICATOR OF ERIDEMIOLOGICAL RELIABILITY IN WATER DISINFECTION IN WATER SUPPLY STATION (AT…
A: Introduction To kill bacteria in drinking water and swimming pools, chlorine and chlorine-based…
Q: osmoregulation and Its Function in our Body
A: Osmoregulation is the procedure of maintaining salt and body fluids balance (osmotic balance) across…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: What role does each component of the ear play in transmitting vibrations that enter the outer ear…
A: The ear is a vital organ that is responsible for both hearing and maintaining body balance. The…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: Advantage Proof reading ability of DNA polymerase reads the error added codes in DNA and correct…
Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…
A: For living functions, that is when it comes on to the term that the cell eukaryotic cells require a…
Please you explain why the answer is true or false for this question.
Step by step
Solved in 2 steps
- BASED ON THIS GRAPH: A small community that is heavily infested with mosquitoes was sprayed weekly with the insecticide DDT for several months. Daily counts providing information on mosquito population size are represented in the graph below. Provide a biological explanation for the changes in the mosquito population over time. Use the terms: insecticide resistance/resistant, natural selection, favorable trait, reproduce, mutation/sexual reproductionWhat is gene flow defined as? Group of answer choices A-production of new alleles B-chance loss of alleles in a population C-exchange of genes between populations D-production of new genetic material E-differential reproductive success of individualsName an evolutionary force that decreases genetic variation in a population.
- The Hardy-Weinberg principle states that allele and genotype frequencies remain constant from one generation to the next, as long as specific conditions are met. Choose Yes or No for the conditions that must be met from the providied statement below. 1. Mutations are exponentially occuring 2. All member of the population breed 3. Everyone produces the same number of offspring 4. The population is infinitely large 5. There is no migration in or out of the population 6. No net mutations are occuring 7. Natural selection of beneficial traits is occuring 8. Natural selection is not occuring 9. All mating is completely random 10. Offspring are able to migrate out of the populationThe founder effect is a type of (genetic drift / gene flow) in which individuals in one small group of a large population (establish a new distant population / are the only survivors) and then reproduce.Which of the following is a change in allele frequency due to chance alone? Founder effect Gene flow Genetic drift Bottleneck
- Founder effects are most prominent in geographically, culturally or religiously isolated populations that undergo rapid expansion from a limited number of ancestors, when, as a consequence of low genetic diversity, some alleles become more frequent. True FalseFor each statement, select the genetic evolutionary concept that best represents the description. mating among close relatives the movement of alleles between populations refers to an allele for which all members of a population are homozygous When a small group of individuals found a new population, allele frequencies in the descendants differ from those in the original population.Select all of the processes that can cause changes in allele frequencies. gene flow large population size genetic drift natural selection mutation
- In genetics, what does the term population mean? Pick any species you like and describe how its population might change over the course of many generations.Suppose a population of organisms is in Hardy–Weinberg equilibrium with respect to a gene that has two alleles, Y and y. The YY genotype has a frequency of 0.11, the Yy genotype has a frequency of 0.44, and the y genotype has a frequency of 0.45. Calculate the frequency of each allele to two decimal places. Y allele frequency: y allele frequency:A small community that is heavily infested with mosquitoes was sprayed weekly with the insecticide DDT for several months. Daily counts providing information on mosquito population size are represented in the graph below. Provide a biological explanation for the changes in the mosquito population over time. Use the terms: insecticide resistance/resistant, natural selection, favorable trait, reproduce, mutation/sexual reproduction Use this sentence starter: At the beginning the daily mosquito count (increased/decreased) until month _, then it started to (increase/decrease). This occurred because.. Use NUMBERS FROM THE GRAPH