Q: There are four bones of various types in the body. Name the three divisions (parts of the ear).
A: Introduction Bone:- It is living tissue that makes up the body's skeleton, It is made up of…
Q: How is a child with Type I diabetes similar to a child who is starving? Mark all that apply 2 Both…
A: Type 1 diabetes is a chronic disease with elevated blood glucose levels, in this case, the pancreas…
Q: 5) Snake venom surprisingly has been a found to be a rich source of biologically active peptides.…
A: Introduction - Snake venom is a very toxic saliva that contains zootoxins and is used to immobilise…
Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…
A: Enzymes are the biological catalyst which increases the rate of reaction. The molecules upon which…
Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…
A: Passive tissues are those that suffer muscle contraction when they are not stimulated to stretch but…
Q: Differentiate Kin selection from altruism.
A: View point of Kin Selection:- It believes that reproductive success is the main goal (for other…
Q: State the three main functions of the digestive system.
A: Digestion involves two aspects- mechanical digestion and chemical digestion. Mechanical digestion is…
Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…
A: The above clinical presentation is a typical of a provisional diagnosis of Iron deficiency anemia.…
Q: Robert Koch (a) proposed a set of guidelines to demonstrate that a specific pathogen causes specific…
A: Microorganisms are small living organisms some of which are pathogenic and cause diseases.
Q: Why might high concentrations of urea unfold proteins?
A: The organic molecule urea, commonly known as carbamide, has the chemical formula CO(NH2)2. A…
Q: Livestock Breed Identification: Cattle
A: Murray Grey is a breed of Australian polled beef cattle. Piedmontese is a breed of domestic cattle.
Q: To explain: In terms of natural selection the reason why no new puriri trees in New Zealand are…
A: The Keruru birds are native pigeons found throughout New Zealand. Many trees rely solely on these…
Q: 15. Why is PK > PNa and by about how much?
A: After discovery of electricity, scientists discovered that conduction from brain to muscle was…
Q: Which are true about tick-borne bacterial diseases? Select which true O One example is the West Nile…
A: Examples for tick borne bacterial diseases include Lyme disease, Rocky Mountain Spotted Fever,etc.…
Q: Why do systems of classification keep on changing? Do you see this as good or bad? Why do you say…
A: Introduction Classification system:- The classification system is the establishment of a…
Q: The following pedigree shows a particular trait which is absent in the parents but found in the…
A: Introduction - A pedigree chart is a graphic that depicts the prevalence and appearance of…
Q: answer 1,2,3,4,5,6,7 and 8. 1. Diphyllobothrium latum 2. Taenia saginata 3. Taenia solium 4.…
A: Answered 1234
Q: Which of the following is not part of a carpel? O anther O style O stigma O ovary
A: The central whorl of a flower is made up of leaflike, seed-bearing components. The pistil is made up…
Q: Root hairs increase the surface area of the root O increase water absorption increase nutrient…
A: Water and mineral nutrients move from the soil to the upper parts of the plants through the xylem.…
Q: Olivia is a wilderness tour guide and spends her day hiking in the mountains. She uses 412 moles of…
A: As per question, Olivia uses 412 mol of ATP. The source of ATPs to be considered are the fats…
Q: Which is true about Creutzfeldt-Jacob disease? Select all that apply. O it is caused by a prion O It…
A: Creutzfeldt jacob disease is the neurodegenarative brain disorder that ultimately leads to tge…
Q: List and explain pre-analytical errors that can occur with a specimen and how these errors can…
A: Pre-analytical stages occur during patient preparation, sample collection, sample transportation,…
Q: 15. Why is PK > PNa and by about how much?
A: A characteristic pattern of the rapid rise and subsequent drop in voltage or membrane potential…
Q: 32) An origin of replication is given below. Sequences of selected parental strand regions are…
A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…
Q: To explain: In terms of natural selection the reason why no new puriri trees in New Zealand are…
A: The Kereru birds are native pigeons found throughout New Zealand. Many trees rely solely on these…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Strain X. spp. is a rod-shaped, anaerobic, Gram-positive bacterium with peritrichous flagella and…
A: Given information Doubling time 240 minutes = 4 hours. Initial population = 10 cells Final…
Q: whether they are hypotonic or hypertonic, does it have a correlation to why they are bony or…
A: For better understanding, let's understand by knowing the terms used in the question. Hypertonic…
Q: How is the final rate of transcriptionof a gene specified by the hundreds ofproteins that assemble…
A: DNA is referred to as a genetic material that is present in the living organism from a single…
Q: Why did Mendel self-pollinate the tall F1 plants to get the F2 generation and crossed a pure…
A: Introduction - The law of dominance, the law of segregation, and the law of independent assortment…
Q: Body organisation in Hydra is of- (A) Tissue grade (B) Organ grade (C) Cellular grade (D) Organ…
A: Hydra- is a freshwater organism which belongs to Cnidaria phylum & class hydrozoa.
Q: How do protists vary in their means of obtaining nutrients?
A: Introduction :- Algae, amoebas, euglena, plasmodium, and slime moulds are examples of protists.…
Q: How are the alleles of a gene different from each other? What is its importance?
A: Alleles are different variants of the same gene that are genetically different . For example, a gene…
Q: What character does the term rhizarian indicate about the forams and actinopods?
A: Rhizaria are an ill-defined, species-rich supergroup consists mostly of unicellular eukaryotes.…
Q: Photosynthesis is the most important producer of molecular oxygen (02) on our planet. From which…
A: Introduction - Photosynthesis is the means used by plants and other organisms to convert light…
Q: In the Chesapeake Bay estuary, the blue crab is an omnivore that eats eelgrass and other primary…
A: Introduction Food Web:- It is the interconnected food network between the organisms that are not…
Q: of В C
A:
Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…
A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…
Q: Plant species with male and female flowers borne on separate plants are termed monocots monoecious…
A: The plant which bears both male and female flowers on separate individual are known as Dioecious…
Q: The profile includes 4 STR loci. (D8S1179, D21S11, D7S820, CSF1PO) At how many of these is the…
A: Short Tandem Repeat Analysis STR analysis is a molecular technique by which short tandem repeats…
Q: How can we improve the prevention and control of parasites?
A: Promoting safer sexual practices, preferably using a condom. Promote regular washing of hands…
Q: Consider a species in which females are more likely to breed and have successful offspring than…
A: As we know animal breeding is a type of selective breeding of domestic animals whose goal is to…
Q: Double fertilization results in __________________________. a. a diploid zygote and triploid…
A: In flowering plant reproduction, double fertilisation is the union of the egg and sperm, as well as…
Q: Why are viruses considered “obligate intracellular parasites”? What does it mean to be “obligate”?
A: Introduction :- Intracellular parasites are microscopic parasites that can grow and reproduce inside…
Q: QUESTION 28 The flies in the figure are mated. Which chromosomes would have the highest frequency in…
A: A breeding experiment among two animals that are exactly hybrid for two features is referred to as a…
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A: The answer is option D.8.7×10 power 6.
Q: Which of the following amino acids would you expect to find more often near the center of a folded…
A: Proteins are biomolecules made up of long chains of amino acids. It is macronutrient that is…
Q: Key properties of proteins include: O a. A wide range of functional groups and an ability to possess…
A: A protein is the large biomolecule (macromolecule)made up of amino acids subunits.
Q: Why do many biologists classify red algae and green algae with land plants?
A: Red algae are also known as Rhodophyta are algae species that are mostly found in freshwater and one…
Step by step
Solved in 3 steps
- Of the encircled portions in the figure, determine what is the schlerenchyma cells?which onion cell type is the smallest under a microscope? Which onion cell type is the largest under a microscope?carefully sketch 3 or 4 onion epidermis cells showing their shape and arrangement label: cell wall, nucleus, cytoplasm, central vacuole of one cell
- Identify the plant cell. What do you this is the dark purple staining structure in the image? What is the function of these cells shown above? Where do you this this sample is taken? What root crop is this tissue cells taken?Now examine the demonstration slide of a c.s. of an immature lily anther and identify the four pollen sacs, or microsporangia (see text Figure 19-14a, page 466). Note the layer of cells immediately surrounding the microspore mother cells (microsporocytes, or pollen mother cells). This is the tapetum. 3. Label the pollen sacs and microsporocytes in Figure 2. below. Figure 2. Lilium immature anther c.s. Photo by Carolyn Alling 4. What is the ploidy level (haploid or diploid) of the microspore mother cell? Of the megaspore mother cells? (29/10 19eal to toping 125Label the following structure/s: (Figure 2) Potato tuber cells with starch grains, label the parenchyma cells.
- Label the following as A, B, C, D Foot/ Seta/ Capsule Sporangium/ Spore mother cellsWhy are internal secretions in specialized cells and not in a regular parenchyma cell which has vacuole as waste depot?Indicate which onion root tip shows prophase, metaphase, anaphase, and telophase. Answer at least 8