Q: In peas, tall stems & axial flowers are dominant to dwarf stems & terminal flowers, which are…
A: Mendel performed his experiment using pea plant. He described a plant have two traits one is…
Q: The same chromosome can look very different depending on when in meiosis it is observed. Explain…
A: Chromosomes appear very differently depending on where they are observed in the cell cycle.
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: Which of the eight parents are definitely heterozygous for Type O Allele?
A: ABO blood grouping is a type of multiple allelism. The different type of alleles are - Type A (IA)…
Q: Column 1 will list ALL characteristics you have identified or tested (include a Gram reaction, shape…
A: There are few important points that should kept in mind : As we know that bacteria are microscopic…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…
A: Introduction :- Cytosine, along with adenine, guanine, and thymine, is one of the four nucleobases…
Q: We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel. Number the largest…
A: Lambda-DNA The lambda DNA is approximately 48502 base pairs in length. It can be cleaved by 12…
Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.
A: The term homeostasis was given by Canon (1960). It is the mechanism by which stable chemical and…
Q: 13 ATLAS 14 (coudal view)
A: Atlas Vertebrae: 3. Transverse process 13 and 6.. Foramen transversarium 5. Foramen of dense 9.…
Q: 22 Complete the following statements to describe how to malntaln a balance between energy input and…
A: Answer
Q: Is the plant with the yellow flower above a eudicot or a monocot? What about the plant with the…
A: * The plant with yellow flower is comes under eudicot. * This yellow flower bearing plant is called…
Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…
A:
Q: Patients who are taking herbal remedies or dietary supplements do not need to list them on…
A: False...
Q: acillus cereus bacteria, in staining reaction tests, such as A.simple staining B.gram staining C.…
A: Answer
Q: is/are meristematic? -
A: INTRODUCTION Because plants are stationary, they have been given tissues made up of dead cells that…
Q: The pigments, energy reserve products, and cell walls found in land plants are also characteristic…
A: Introduction A cell wall is a structural layer found just outside the cell membrane that surrounds…
Q: Suppose gene B is X-linked and is embryonically lethal when homozygous or hemizygous recessive. A…
A: Let us first discuss the terms used in the question, Homozygous:- A condition when two copies of an…
Q: Cloning is the replication of all or part of an organism. Although cloning is still a developing…
A: Cloning is a technique scientists use to make exact genetic copies of living things. Genes, cells,…
Q: A distinguishing characteristic of Eukaryotes is that they contain membrane-enclosed organelles and…
A: The presence of a nucleus distinguishes eukaryotes from prokaryotes. Eukaryota is one of the three…
Q: Match each item with the correct statement below. Nonpharmacologic methods to manage…
A: Introduction :- Both Crohn's disease and ulcerative colitis are inflammatory bowel diseases. Crohn's…
Q: Of the circled parts, indicate which numbers is/are parenchyma cells 1
A: There are various characters to be considered to indentify parenchyma cells. The major characters…
Q: To explain: Why the cancer treatments cause hair to fall out.
A: Cancer is a well known that they're supposed to define that they are condition in which cells grow…
Q: Parasitic alveolates that form spores at some stage in their life belong to which group? (a)…
A: * The answer of the question is option D that is apicomplexans. * Parasitic alveolates that form…
Q: Give an example of an industrial/clinical setting where quantifying viable bacteria would be useful.…
A: Quantifying viable bacteria is useful :-
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A: The answer is option D.8.7×10 power 6.
Q: What hookworm penetrate into the skin and causes potbelly of malnutrition, microcytic and…
A: The Hookworm species which causes infection inside the human beings are ancylostoma duodenale and…
Q: In a particular dihybrid (T/t, B/b) the alleles of the "T and "B"genes indicated in the figure below…
A: Meiosis is a process where a single cell divides twice to produce four cells containing half the…
Q: D. Rectum 11. An eosinophil is classified as a A. Red blood cell B. White blood cell C. Platelet D.…
A: Blood contains many types of cells: white blood cells, red blood cells (erythrocytes), and…
Q: when XRCC2 DNA sequence CTC is changed to CCC (which causes a missense mutation converting Leu to…
A: The mutation is simply defined as a process in which the sequence of DNA of any organism changes.…
Q: Probably the best local example of primary ecological succession, and the place where Henry Cowles…
A: Ecological succession is the process of change in the species structure of an ecological community…
Q: To explain: The way in which the shortened telomeres affect the life-span of IPSCS and…
A: Stem cells are an undifferentiated mass of cells that can differentiate into specific cell types.…
Q: What is bacillus cereus ?
A: Microbes are the small sized organisms that can't be seen by naked eyes. The microscope is used to…
Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…
A: Genetic code is the 3-letter combination of nucleotides, known as codon, each of which specifies to…
Q: Gel-filtration chromatography separates molecules according to their size . Smaller molecules…
A: Gel-filtration chromatography is a type of separation technique that uses a gel as a medium through…
Q: 9. Most species of Clostridium, which are widely distributed in the environment, are harmless to…
A: Infection is the entrance of pathogens into an organism's bodily tissues, their growth, and the host…
Q: Construct a schematic diagram on how ACE inhibition assay is performed based on the protocol given.…
A: k to library ACE Inhibition Assay Use in OneLab Abstract Overview Protocol Contact info OneLab is a…
Q: The example that relates to the law of supply and demand and mention the ways opted by the humans…
A: Natural resources provided by the biosphere meet the basic needs of over six billion people. Human…
Q: Choose an organism (plant or animal) and write its common name on the line below. Write the…
A: The earth's biosphere consists of many animals and plants and studying them individually is a…
Q: A review of the phylogenetic tree shows a common ancestor for these vertebrates. Which statement…
A: Phylogenetic tree of vertebrates showing common ancestor.
Q: Based on the data below, which of the following statements best describes an effect of population…
A: Population density is defined as the number of individuals found in a particular area.
Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…
A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…
Q: explain indole test, startch test and citrate test.
A: Indole test This is a biochemical test that is used to identify the capability of some bacteria to…
Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…
A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…
Q: What, generally, does the forest transition theory predict? Should its predictions bereceived as…
A: The terms 'eco' and 'system' allude to a region of the world and the coordinating entities,…
Q: 2. Consider the populations (1000 individuals) with the following genotypic frequencies: Population…
A: Note: As Per Guidelines, We Can Answer One Question or 3 sub parts of a question At A Time. Ask…
Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?
A: Chromosome is a long thread lie structure which comprises of hereditary units known as genes . These…
Q: Jimsom. weed plants can produce purple or white flowers and spiny or smooth seed pods. A purple…
A: Given Parent 1 phenotype - purple spiny Parent 2 phenotype - white spiny Cross result 89 purple…
Q: A person with diabetes cannot regulate their blood sugar because their pancreas does not release…
A: If you have diabetes: Your glucose levels will continue to rise after you eat because there's not…
Q: What suggestions would you give for improving one’s immune system? Please explain the reasoning…
A: Immune system is very important for the proper functioning of body, without immune system our organs…
Q: Assuming that the histone octamer forms a cylinder 9 nm in diameter and 5 nm in height and that the…
A: Introduction The genome is an individual's complete set of genetic information that contains all of…
Step by step
Solved in 2 steps
- The movement of mineral nutrients through organisms and their environment is called a __________cycle. biological bioaccumulation biogeochemical biochemicalCarbon, hydrogen, and oxygen are _______ for plants. a. macronutrientsd b. micronutrientse c. trace elements d. required elements e. both a and b f. both a and dFigure 46.17 Which of the following statements about the nitrogen cycle is false? Ammonification converts organic nitrogenous matter from living organisms into ammonium (NH4+). Denitrification by bacteria converts nitrates (NO3-) to nitrogen gas (N2). Nitrification by bacteria converts nitrates (NO3 ) to nitrites (NO2-). Nitrogen fixing bacteria convert nitrogen gas (N2) into organic compounds.
- Phosphorus immobilization occurs when: O a plant absorbs phosphorus from the soil, and converts it into ATP phosphate rich rock undergoes weathering, releasing biologically-available phosphorus into the environment O a coyote dies, and as it decomposes, it releases phosphorus back into the environment62. The deposits which can be found at the Nile River in Egypt is an example of O Colluvium O Loess O Eolian O Delta O Alluvium 21 s aWhich nitrogen flux is incorrectly described? O nitrification is the conversion of ammonium to nitrates nitrogen mineralization is the conversion of organic nitrogen to inorganic nitrogen nitrogen immo bilization is the conversion of ammonium to metamorphic rock O denitrification is the conversion of nitrate to nitrogen gas O nitrogen fixation is the conversion of nitrogen gas to bioavailable forms of nitrogen
- Which of these statements about mineralization is not true? a. Mineralization means that elements are permanently lost from the biosphere b. All animals conduct mineralization, while decomposition is a specialized feeding strategy c. The metabolic conversion of sugar to CO2 is an example of mineralization O d. Elements that have been mineralized can be taken up by primary producers or bacteriaACID RAIN Acid rain occurs due to the presence of certain pollutants in the atmosphere. Acid raiñ"can belcaused by the combustion of fossil tuels, erupting volcanges, or rotting vegetation that releases sulfur dioxide and nitrogen oxide into the atmosphere. When fossil fuels such as coal, gasoline, and fuel oils are burned, they emit oxides of sulfur, carbon, and nitrogen into the air. These oxides combine with moisture in the air to form sulfuric acid, carbonic acid, and nitric acid. The term "acid rain" is also applied to other forms of precipitation-snow, hail, sleet, and fog-that are similarly acidic. During the 20th century, acid rain was recognized as a leading threat to the Earth's environment. Most acid rain comes from fossil fuel emissions produced in the industrialized northern hemisphere--the United States, Canada, Asia, and most of Europe. Acid rain is devastating to all forms of life, but its effects are especially severe in freshwater habitats such as lakes, rivers, and…* © 54% a hcisd.instructure.com accumulates in soil and water. Some forms of DDT decompose slowly. Worms, grasses, algae, and fish accumulate DDT. Apex predators, such as eagles, had high amounts of DDT in their bodies, accumulated from the fish and small mammals they prey on. Birds with high amounts of DDT in their bodies lay eggs with extremely thin shells. These shells would often break before the baby birds were ready to hatch. DDT was a major reason for the decline of the bald eagle, an apex predator that feeds primarily on fish and small rodents. Today, the use of DDT has been restricted. The food webs of which it is a part have recovered in most parts of the country. Answer the following questions based on the reading in paragraph format. 1. Describe what DDT is and how does it impact the food web. 2. Do you think humans health can be affected by hazardous bioaccumulates in an ecosystem? Make sure you explain using a statement from the reading. 3. Do you think DDT is the only…
- Match the following biogeochemical cycles terms to the correct definiton. In this cycle the absorption of this 1. bio-essential element from the atmosphere increases the pH of the oceans. The main reservoir of this nutrient 2. is in the building block for all necessary biomolecules (fats, proteins, and carbohydrates) that constitute an important part of the inorganic matter. The element of this cycle is stored 3. in long-term in Carbonate rocks (e.g., limestone) And Fossil carbon (e.g., oil, coal) SInk The material flows in from the 4. reservoir. Source The reincorporation of this 5. element in its cycle is slow Carbon cycle because a considerable amount of it is stored in animal epidermal Phosphorus cycle alpha-keratin protein filaments. In this cycle the fungi from 6. the Rhizobium family helps in the Nitrogen cycle fixation of this element into the soil. Most plants cannot access this 7. nutrient from the atmosphere; therefore, they obtain it from the soil. This cycle refers to a 8.…The extreme heat and pressure that converts limestone into marble occurs during a process called sedimentation erosion melting metamorphism O mineralizationmarine-plastics-pollution suluton in a
