Let’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain. Why might this have failed? List as many reasons as you can think of.

Let’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain. Why might this have failed? List as many reasons as you can think of.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section15.1: The Connection Between Dna, Rna, And Protein

Problem 1SB

See similar textbooks

Similar questions

A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimetho- prim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mam- malian cell mutants defective in thymidylate synthase?
A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimethoprim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mammalian cell mutants defective in thymidylate synthase?
In a cotransformation experiment (see question 4 of More GeneticTIPS), DNA was isolated from a donor strain that was proA+ andstrC+ and sensitive to tetracycline. (The proA and strC genes conferthe ability to synthesize proline and confer streptomycin resistance,respectively.) A recipient strain is proA− and strC− and isresistant to tetracycline. After transformation, the bacteria werefirst streaked on a medium containing proline, streptomycin, andtetracycline. Colonies were then restreaked on a medium containingstreptomycin and tetracycline. (Note: Each type of medium hadcarbon and nitrogen sources for growth.) The following resultswere obtained:70 colonies grew on the medium containing proline, streptomycin,and tetracycline, but only 2 of these 70 colonies grew whenrestreaked on the medium containing streptomycin and tetracyclinebut lacking proline. If we assume the average size of the DNA fragments is 2 minutes,how far apart are these two genes?
It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
After mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B) that, unlike the wild type cells, fail to luminesce when grown to high density in a flask with appropriate medium. Curiously, however, when you inoculate both mutant strains in the same flask, you observe that the mixed (A+B) culture begins to emit light after growing dense. a) What gene/functions are likely affected in each of the two mutants? b) How does this explain their phenotypes?
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explain
Consider the following experiment. First, large populations of two mutant strains of Escherichia coli are mixed, each requiring a different, single amino acid. After plating them onto a minimal medium, 45 colonies grew. Which of the following may explain this result? A) The colonies may be due to back mutation (reversion). B) The colonies may be due to recombination. C) Either A or B is possible. D) Neither A nor B is possible.
You are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1? ( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.
Emtricitabine (2',3'-dideoxy-5-fluoro-3'-thiacytidine, abbreviated as FTC) is a nucleoside analog that is used to treat HIV. It works by reversibly binding to HIV reverse transcriptase (HIV RT) and by doing so, inhibits the virus from replicating itself. In an experiment, FTC and purified HIV RT are mixed at low concentrations and allowed to reach equilibrium. The concentrations measured are [FTC] = 10 nM, [HIV RT] = 37.5 nM, and [HIV RT-FTC] = 2.5 µM, for the equilibrium FTC + HIV RT= HIV RT-FTC. What is the Kd in nM?
From an Escherichia coli strain, five Hfr strains were isolated. The location and orientation of the transfer origin of each Hfr strain is shown in Figure 1. You want to use these five strains to map the locus responsible for thiamine synthesis, called thi. Each Hfr strain is sensitive to rifampicin (Rifs) and thi*. Conjugation experiments are performed between each of the Hfr strains and an F strain Rif Thi™. 0 T leu 10 20 T nadD pyrC trp 40 T his 60 70 2) The results are shown in the following table: Donor strain Hfr1 Hfr2 Hfr3 Hfr4 Hfr5 cysG 80 90 1) What is the selection medium used in these conjugation experiments metA Colonies Thi+ 1000 0 400 0 25 100 Hfr1 Hfr2 Figure 1: Chromosome map of Escherichia coli. Five Hfr strains (Hfr1 to Hfr5) were isolated and the location and orientation of the origin of transfer is shown by the arrows in each Hfr strain. Distances in minutes are shown. Leu: leucine biosynthesis; nadD: NAD biosynthesis; pyrC: pyrimidine biosynthesis; trp: tryptophan…
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG