Q: Which of the f Dinding buffer 7
A: Introduction: A plasmid is a small, circular, double-stranded DNA molecule that is separate from the…
Q: Briefly describe the means we use to classify acellular microorganisms. *keep it short*
A: Introduction :- Acellular microorganisms are microorganisms that do not have a cell membrane or…
Q: How are fats digested mobilized and transported inside the body in the fed and fasted states
A: INTRODUCTION Fats are one of the three macronutrients found in the human diet, alongside…
Q: 3. What are the methods of creating anaerobic conditions for the cultivation of microorganisms?
A: Introduction :- Anaerobic microorganisms are microorganisms that grow and thrive in the absence of…
Q: a) Which concentration of anesthetic has the least variation in it's effect on muscle contraction?…
A: Introduction Muscular contraction is the process by which a muscle shortens in length and generates…
Q: Why would anadromous salmon be considered good indicators of both marine and terrestrial ecosystem…
A: Introduction :- A marine ecosystem is a complex and diverse community of plants, animals, and…
Q: What kind of exudates do you expect to find in the soil? What does phytoremediation mean in this…
A: There are two major types of riot exudates found in soil. [1] Low molecular weight compound (LMWC)…
Q: Define Fragmentation Reproduction in spirogyra (Breif)
A: In Spirogyra reproduction takes place by three methods vegetative reproduction sexual reproduction…
Q: Explain lysogenic conversion and discuss it’s importance. *keep it short*
A: Viruses are obligate intracellular parasites that lives inside a host cell. It can undergo lytic…
Q: Which of the following statements is true about the above diagram? the signal molecules bind to the…
A: The correct answer is the third option.
Q: Name Example: C₂H4 HH H-C=C-H 1. C4H10 2. C6H12 3. C4H₂OH
A: Introduction : An atom or group of atoms that are attached to a molecule in a particular way is…
Q: Net moles of ATP produced by one mole of acetyl CoA entering the TCA cycle is: O 2 9 38
A: The TCA cycle, also known as the citric acid cycle or the Krebs cycle, is a series of chemical…
Q: The epinephrine signaling pathway plays a role in regulating glucose homeostasis in muscle cells.…
A: *Cell signaling also called as cell communication, is the ability of a cell to receive and process…
Q: For each of the following statements, indicate whether it is true or false. [Select] [Select] The…
A: Introduction :- LDL, or low-density lipoprotein, is a type of lipoprotein particle that transports…
Q: Which colors are least represented, or absent, in the 2nd population? Use at least one buzzword…
A: Predation in a population is an ecological restoration in which an organism called predator kills…
Q: This is a two part question: Please complete part a and part b, failure to complete both, you will…
A: The diagram below shows meiosis which is the kind of reduction division in which the chromosome…
Q: Notice that when comparing our amino acid sequence to a fruit fly, we have a difference of 29 amino…
A: Various techniques have been used to study the evolutionary relationships among organisms, amino…
Q: If the Go for ATP hydrolysis into ADP + inorganic phosphate is 7.3 kcal/mole, and the Go for…
A: Introduction :- Inorganic phosphate (Pi) is a negatively charged ion that plays a key role in energy…
Q: 1) If TT is mated with Tt, how many of the offspring will genotypically turn out as tt? 2) If TT…
A: Introduction Genetics is a branch of science which deals with the study of gene and heredity. The…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please…
A: 1) Osteoporosis is a common medical condition characterized by decreased bone density and increased…
Q: A cross in plants is done between the parents CCDD and ccdd to create a dihybrid F1 plant. This F1…
A: Introduction: Genetic variation refers to the differences in genetic material that exist among…
Q: To what energy budget item is an excess or shortfall in intake credited or debited? (More than one…
A: Energy balance is a crucial aspect of human physiology that refers to the balance between energy…
Q: C a b. d e f h
A: Introduction: The foundation of the nervous system are neurons. They communicate with various body…
Q: Are there potential benefits to coconut oil?
A: Coconut oil has gained attention for its health benefits in recent years largely due to the…
Q: Write a journal-style Method section detailing what you did to grow your ''Fungal Garden''
A: I have always been fascinated by the world of fungi and their potential to provide sustainable food…
Q: Max has the trait for colorblindness, which is an X-linked condition. If Max mates with Jenny who is…
A: Let's assume XN be the dominant allele, while Xn be the recessive allele. We know colour blindness…
Q: 3. What health teachings can you give to the donor of the fecal sample who was found to have these…
A: The donor of a fecal sample has been found to have parasites, which can cause a range of health…
Q: Which of the following are true regarding assay attributes? List all that are true. a) Accuracy…
A: Assays are widely used in biological and medical research to measure the concentration of biological…
Q: The figure below shows an absorption spectrum of DNA obtained using NanoDrop. Is this DNA…
A: Option B Contaminated with RNA
Q: Explain the potential dangers, risks, and harms of combining marijuana with each of the following…
A: Introduction Marijuana, also known as cannabis, is a naturally occurring plant that contains…
Q: Do dinoflagellates push or pull themselves through the water with their flagella? How does this…
A: Dinoflagellates are protists that play an important role in ocean ecosystems, and they possess…
Q: Chicken feathers have long been discarded by the poultry industry until recently. What is now being…
A: Enzymes are proteins that act as catalysts in biochemical reactions. They speed up the rate of a…
Q: Normally, an increase in the blood concentration in leptin would cause (More than one answer may be…
A: Leptin is an protein hormone which is 167 amino acids long secreted by fat cells i.e, adipocytes and…
Q: a population with 2 alleles Z and z, where Z is the dominant trait. If you have a population of 50…
A: According to the Hardy-Weinberg equilibrium principle, the frequency of alleles and genotype will…
Q: Flowering plants are greatly different from conifers and other gymnosperms in their: O Parenchyma,…
A: INTRODUCTION Flowering Plants Flowering plants, also known as angiosperms, are plants that produce…
Q: Natural selection can be defined as: chance differences in organism traits. the chance for species…
A: Introduction :- Natural selection can be defined as the differential survival and reproduction of…
Q: 2. Methods that used to determine the enzymatic activity of bacteria
A: Introduction Bacteria are single-celled microorganisms that can be found in almost every…
Q: Random orientation of homologous chromosomal pairs along the metaphase plate of the cell occurs…
A: Introduction : A single cell divides twice to form four cells during the meiosis process. The…
Q: 8. You perform a PCR experiment using the template and primers shown below. What size is the…
A: PCR stands for Polymerase Chain Reaction. It is a laboratory technique used to amplify a single or a…
Q: rotifers feed more on unicellular yeast
A:
Q: In a 0.1 M lysine solution, what are the individual concentrations of the protonated C-terminus…
A: In a 0.1 M solution of lysine, the protonated form of the amino acid has a concentration equal to…
Q: Provide 5 membrane bound organelles and their functions.
A: Introduction : Organelles with a biological membrane around them are called membrane bound…
Q: The NMDA receptor I/V curve is nonlinear, why? What about the GluA2-containing AMPA receptor I/V…
A: Introduction: The nervous system, a complex network of specialized neurons and supporting cells…
Q: Distinguish between a solute, solvent and a solution
A: Solute, solvent and solution are important terms in biochemistry and Chemistry. These are very…
Q: Catastrophism founded the science of paleontology. true or false
A: Introduction :- Paleontology is the study of fossils, which are the remains or imprints of ancient…
Q: You
A: Introduction: According to this model, in a large, isolated, and randomly mating population, the…
Q: research medical conditions? Can you explain the technology distinctions between face-to-face and…
A: Today web or internet offers each and every type of information ready on the platter. It is upon the…
Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…
A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…
Q: In a species of fish, the allele for long fins (F) is dominant over the allele for short fins (f).…
A: Given:- The allele for long fins (F) is dominant over the allele for short fins (f). we cross a…
Step by step
Solved in 3 steps
- Why is the decreased affinity of fetal hemoglobin for BPG advantageous? With fewer BPG molecules bound to heme, there are more heme residues available for O2 binding. O A. B. Decreased BPG binding biases the fetal hemoglobin toward the R state. C. More free BPG is available to bind to adult hemoglobin, resulting in a shift to the R state. BPG is more available to bind to fetal myoglobin. helping to release O2 in fetal muscle tissue. D. 47The hemoglobin in mammalian blood is usually thought ofsimply as increasing the amount of O2 that can be carried by eachliter of blood. However, in a lecture on hemoglobin, a respiratoryphysiologist made the following statement: “The presence ofhemoglobin in the blood also makes possible the rapid uptakeof O2 by the blood as it flows through the lungs.” Explain thelecturer’s point.Help me please
- Hemoglobin and myoglobin both use heme as their prosthetic group and they both bind O2. However, their O2-binding curves indicate these proteins have different activities. What lind of information can be learned about the differences between the curves?Under appropriate conditions, hemoglobin dissociates into its four subunits. The isolated α subunit binds oxygen, but the O2 -saturation curve ishyperbolic rather than sigmoid. In addition, the binding of oxygen to the isolated α subunit is not affected by the presence of H+, CO2 , or BPG. What do these observations indicate about the source of the cooperativity in hemoglobin?Which of the following is incorrect about 2,3-bisphosphoglycerate (BPG)? It is highly (-) charged b. It prevents binding of O₂ to hemoglobin Oc. It binds only to the relaxed (oxy) conformation of hemoglobin Od. It binds in the space between the four subunits of hemoglobin a.
- (b) The diagram on the right compares O2-dissoci- ation curves for human hemoglobins characterized by dif- ferent p50 values. If Ko2 represents the equilibrium disso- ciation constant for oxygen binding, e.g., Hb(02)n Hb + nO₂ show the relationship between Ko2 and p50. Assign one of the curves (a, b, e) that best approxi- mates the Ko2 of each of the mutant hemoglobins in the table above including HbA where Ko2 represents the equi- librium dissociation constant for oxygen binding. If no curve is present for any of the mutant hemogobins, state the rea- son why the mutant is not represented. Indicate on the graph where its p50 would lie. PERCENT SATURATION 100- 80- 60- 40- 20- PARTIAL PRESSURE OF OXYGEN lungs veins muscle 0- 0 20 bc/d T 100 120 140 40 60 80 OXYGEN PRESSURE (millimeters of mercury) (c) Of the mutant hemoglobins in the table above, which form a hydrogen bond stabilizing the R (oxy) conformation similarly to that in wild type HbA. Justify this statement on the basis of the…Below is a fractional saturation curve for O₂ binding to adult hemoglobin. Assume that curve Y represents a condition at pH 7.4 and with a normal physiological level of 2,3-BPG. Curve X represents a condition that Fractional saturation (0) 0.2 0.0 0 Tissue PO, (kPa) 12 Lungs1. Is this statement correct or incorrect? Explain. During strenuous exercise, the oxygen-hemoglobin dissociation curve shifts to the right. This rightward shift reflects an increase in the affinity of hemoglobin for oxygen and favors loading of O2 onto hemoglobin in the lungs. 2. Is this statement correct or incorrect? Explain. Compared to hemoglobin, myoglobin has a lower binding affinity for O2 and a higher O2 binding capacity, two characteristics that allow myoglobin to efficiently provide skeletal muscle cells with a readily-accessible reservoir of O2.
- Oxygen affinity of fetal blood is higher than that of maternal blood and may help to provide the fetus with an adequate oxygen supply during pregnancy. In mammals, 2, 3-biphosphosphoglycerate (BPG) mediates intracellular hemoglobin function by lowering cxygen affinity. Fetal red blood cells have higher affinity for oxygen because of a smaller effect of BPG on oxygen affinity of fetal hemoglobin (Hb F) compared with adult Hb (Hb A). Which symbol shows the PS0 value corresponding to Hb F? 14 12 10 0.0 0.5 1.0 1.5 2.0 2,3-BPG (mM) O Crcle O Dimond O Square O Triangle (6H ww) dIn most species of mammals, the O2 affinity of a fetus’s bloodhemoglobin is greater than that of its mother’s blood hemoglobin.However, mammal species are not all the same in the mechanismthat causes the affinities to be different. Specify three distinctmechanisms for the difference in affinity between fetal andmaternal blood hemoglobin. Considering the mechanism of the fetal–maternal difference in O2 affinity, would you say that the evolution of themechanism provides evidence for Jacob’s argument? Explain.Our human hemoglobin is 100% saturated near the alveoli and 80% saturated after passing through the systemic capillaries and moving back into the veins. By contrast, an extraterrestrial friend's oxygen-binding molecule is 100% saturated near their alveoli and 60% saturated after passing through their systemic arteries and moving back into the veins. How does his hemoglobin compare to yours? a. they deliver a larger share of oxygen to their tissues at rest b. the partial pressure of O2 in their alveoli is higher than ours c. the oxygen- binding molecule in their circulatory system is worse than ours d. the partial pressure of O2 in their tissue is lower than ours