Identify the following structures of flowers: Answer only numbers 12, 33, and 34. eproductive Struc. Prac.Quiz-converted.pdfOpen with33.35.34. Open with -11 wholeeproductive Struc. Prac.Quiz-converted.pdfstructure12 whole structure1314encircledpartPage3 I 14

The first image is that of a fruit and the second image is of a cross section of anther and ovary

Answered: Identify the following structures of…

Science

Biology

Identify the following structures of flowers: Answer only numbers 12, 33, and 34.

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter2: Basic Hematology

Section2.9: White Blood Cell Differential Count

Problem 8RQ

See similar textbooks

Related questions

Q: Differentiate between chasmogamous and cleistogamous flowers.

A: The plants consist of roots, stem, leaves, fruits and flowers. The conduction system in plants are…

Q: Please label the whorls of a typical flower shown here. For each letter you must provide the name of…

A: Flowers are made out of numerous different parts: sepals, petals, stamens, and carpels. These parts…

Q: which flower color is dominant, purple or white?

A: Each trait has two forms at the gene level. The trait which is visibly expressed or appears in the…

Q: 6.11 Label the following flower parts on the image below: sepal, petal, pistil, stigma, style,…

A: Angiosperms consist of flower which has versatile shapes and structures for pollination. Different…

Q: Write the floral description of the following floral formula: A. ⊕♀️ K4 C4 A2+4 G(2)…

A: Here, there are two floral formulas are provided in which each symbol has a specific meaning. A. ⊕♀️…

Q: Draw and classify the inflorescence of MAYANA FLOWER

A: Mayana is also refers to as Coleus blumei or Coleus atropurpureus .It generally belongs to family…

Q: Name, locate, and describe the four whorls of a flower.

A: The sexually reproducing plants have a modified shoot in the form of a flower. The flower is a…

Q: nflorescence and their examples? Discuss clearly and label each types and examples.

A: I) Solitary Terminal: Single blossom (ii) Solitary Axillary: Single blossoms happen in the axils of…

Q: What is the floral formula of Citrofortunella microcarpa (calamansi)? Illustrate the floral diagram.

A: Citrofortunella microcarpa (calamansi) is a hybrid citrus species of lemon commonly called…

Q: What are these symbols mean in making a cross floral diagram?

A: Need to find what are these symbols denotes in cross floral diagram.

Q: In which part of the flower is the dye located?

A: Flowers are the distinctive, reproductive structure of flowering plants that attracts pollinators…

Q: Identify where eggs and pollen grains are formed within the flower.

A: A flower is the conceptive structure found in flowering plants. The natural function of a flower is…

Q: pistillate, staminate, dioecious and monoecious flowers.

A: A flower consists of numerous parts like the petals, sepals, pistil, and stamen. All these parts…

Q: What is the labeled part of solitary and inflorescence flower in these figures

A: Plant species are unique and all of them share a common structure. They consist of two organ systems…

Q: Draw and label the cross-section of the ovary of a grass flower.

A: The ovary is the basal portion of a carpel, which contains the ovules and is located above the…

Q: In Sunflower, If the flower is gamopetalous, are the stamens epipetalous? If so, are the stamens…

A: taxonomic classification is Domain: Eukaryota Kingdom: Plantae Phylum: Tracheophyta Class:…

Q: Write a note on Flower diversity ?

A: Floral diversity refers to the variety of plants that existed in a given area at a given time. It…

Q: Draw and label the fusion of floral parts of BATAW FLOWER

A: Bataw is a nutritious climber with delicious seeds, pods, leaves, blooms, and roots. Although most…

Q: Which of the following statements about a stamen is FALSE?

A: stamen is the part of the male reproductive system of the flower it consists of anther and filament…

Q: Explain the characteristic fragrance of lilac flowers ?

A: Lilacs are easily recognized by their long, often cone-shaped panicles covered in tiny, tubular…

Q: identify and discuss the functions of the parts of a flower.

A: Introduction: Flower is the specific piece of an angiospermous plant that happens independently or…

Q: . Draw CABALLERO FLOWER according to its sexuality B. Identify whether it is pistillate, staminate,…

A: INTRODUCTION Caballero flower is also known as Peacock flower.Following is the…

Q: List the components of a complete flower and their function.

A: Introduction :- The reproductive structure of flowering plants is the flower, sometimes known as a…

Q: Write the floral formula: The flowers are bisexual, actinomorphic and hypogynous. The perianth is…

A: The floral diagram is a graphic or pictorial representation of flower structure that shows the…

Q: Draw and classify the inflorescence of CABALLERO FLOWER

A: This plant is found in tropical and subtropical regions of the United States. It is a straight,…

Q: Bougainvillea, Sunflower, and hibiscus are flowers solitary or arranged in an inflorescence? If Yes,…

A: The arrangement of cluster of flowers on floral axis is called as inflorescence. In…

Q: Name the structure indicated by the letter A. Name the structure indicated by the letter B Name the…

A: In flowering plants, the gynoecium appears as a carpel or a collection of fused carpels in the…

Q: Draw and label the fusion of floral parts of MAYANA FLOWER

Q: Draw and classify the inflorescence of BATAO FLOWER

A: The male and female parts of a plant are combined in the flower, which is the reproductive component…

Q: what are the cross floral diagrams of the hibiscus flower?

Q: What is the term for multiple flowers all on a single stalk, as seen in the picture below?

A: Inflorescence describes the arrangement of flowers on a plant.

Q: 12. 13. 14. 15. O

A: Floral diagrams: It is a graphical representation that gives us information about the arrangement of…

Q: this is a male flower. please draw and label stamen, corolla, calyx

A: Blossoms are made out of numerous particular parts: sepals, petals, stamens, and carpels. These…

Q: Name the largest flower.

A: Flowers are the structures of the flowering plants responsible for sexual reproduction in them.

Q: What is flower and inflorescence? What are their functions, differences and similarities? What are…

A: The plant consist of root,shoot,flower and leaves all these are meant for performing function and…

Q: Trace the offspring of orchid flower up to second generation. Given: P- violet y-yellow Parent: PP X…

A: A trait that is shown in an animal is due to it's gene regulation. Every gene is regulated by the…

Q: Name the plants having male and female flowers or sex organs on the same plant.

A: Flowers are the specialized organs to perform sexual reproduction in the angiosperms. They are…

Q: Name the reproductive part of flower which contain germ cells.

A: Plants are non-motile living beings that are capable of producing their own food utilizing the…

Q: Draw a labeled diagram of the longitudinal section of a flower.

A: Angiosperms are called flowering plants. The flower is the reproductive part of the angiospermic…

Q: List the four sets of floral organs in order from the center of the flower outwards and briefly…

A: Flowers comprise four different organs called sepals, petals, stamens and carpels, arranged in…

Q: What is the labeled part of a solitary flower and inflorescence based on the given text?

A: The solitary flower is not the part of an inflorescence. an inflorescence contains a certain number…

Q: Label the parts of the flower shown above

A: Flowers exist only for the purpose of sexual reproduction, guaranteeing the species' survival.…

Q: What are the variations in floral structure in this cross floral diagram? Note that in epigynous…

A: Angiopserms are flowering plants that have flowers as reproductive organs. Four main whorls seen in…

Q: what flower is this? (is this pea flower or not?) what is the symmetry of the flower? is it complete…

A: Thank you for the question what flower is this? (is this pea flower or not?) Answer : yes,this…

Concept explainers

Angiosperm Reproduction

The process of sexual reproduction in flowering plants is known as angiosperm reproduction. In flowering plants, reproduction begins with pollination, or the transfer of male gametes (pollen) from the male reproductive organ (anther) to the female reproductive organ (pistil), and ends with fertilization of the female gametes (egg), which produces a zygote, which then grows to become a mature plant.

Question

Identify the following structures of flowers:

Answer only numbers 12, 33, and 34.

eproductive Struc. Prac.Quiz-converted.pdf
Open with
33.
35.
34.

Open with -
11 whole
eproductive Struc. Prac.Quiz-converted.pdf
structure
12 whole structure
13
14
encircled
part
Page
3 I 14

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate V
Q:-What is a xaxim?
Which of the following statements is false? Slow fibers have a small network of capillar ies. Slow fibers contain the pigment myoglobin. Slow fibers contain a large number of mitochondria. Slow fibers contract for extended periods.
Please help match the following for part D
Flonase NS #1 ii sprays in each nostril QD. How many days will the medication last?
Refer to the codon diagram on. Which of the following is a codon that will terminate translation? * Phe AGU Cys (C) G Trp (W) G UN A C C Arg (R) Leu (L) A Ser (S) Lys (K) A UG Asn (N) His (H) Thr Gin (Q) (T) Arg (R) lle (1) Ctart 是3 Met
Q56 Select all that apply
5’- TTGACATGCG ATGTCGTAGG GATATATAAT CCACACAGTC GACAATTGAC ATCCCGGTCA CCTATAATCG TGAACACATA TAAGGAGTCT GACTATGGTA AGTAAATATG GTCATTAGTT ATGTGAACAG CCATTGGAGT CCACACTGAC TGAGATTAAG AGATGCCGAT AAAGTGGATA GCATTTTAAC TTGACAATGG ACGATCGATC GTAATTACCA ATGTGAATCG TAGTTGCGCA TTTCGGACGT -3’ a) Counting from the first nucleotide (A) of the Shine-Dalgarno consensus sequence, show the sequence of the first 20 nucleotides in the mRNA encoded by this piece of DNA (specify 5’ & 3’ ends). b) What is the sequence of protein X (specify the amino and carboxyl termini)? c)A mutation occurs in the original DNA strand for protein X such that the adenosine nucleotide at position +35 is deleted. What is the effect of this mutation? d) A mutation occurs such in the original DNA for protein X strand such that the adenosine nucleotide at position +48 is changed to a thymine. What is the effect of this mutation?
B BE -70 Membrane potential (mv) +35 A) A. B) B. C) C. D) D. E) E. C) D) D. C. D 2 Figure 37.1 30) In Figure 37.1, the period in which voltage-gated potassium channels are open and hyperpolarization has yet to occur is at label 3 A) A B) B C) C D) D Time (milliseconds) 31) In Figure 37.1, the membrane's permeability to sodium ions is at its maximum at label A) A. B) B. 4 32) In Figure 37.1, at what point in the graph are sodium channels closed (or closing) and potassiu channels opened? 33) In Figure 37.1, the neuronal membrane is at its resting potential at label A) A. B) B. C) C. D) D. E) E
HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)
Give the letters for the side groups that are likely to interact strongly with blood plasm NH, NH, CH3 NH, H-C-C HN' H-C-C-C-C CH3 H-C-C--C-C A. HN-C NH3 NH, H-C-C-OH H-C-C- -OH H-C-C NH, NH, H-C-C- H-C-C-C-C-C-NH,
hi pls help me answer the ff questions, choose the letter of correct answer only