Answered: How many comparisons needed to find the…

How many comparisons needed to find the first match of the following text and pattern using Boyer Moore, T= "ABACBCACABBA" and P="ABBA"

Np Ms Office 365/Excel 2016 I Ntermed

1st Edition

ISBN:9781337508841

Author:Carey

Publisher:Carey

Chapter3: Performing Calculations With Formulas And Functions

Section: Chapter Questions

Problem 3.13CP

See similar textbooks

Related questions

Q: Use Boyer Moore pattern matching algorithm in the text GTTATAGCTGATCGCGGCGTAGCGGCGAA Pattern:…

A: Required:

Q: Create a truth table for “Some of these kids are rude. Jimmy is one of these kids. Therefore, Jimmy…

A: Given statement is “Some of these kids are rude. Jimmy is one of these kids. Therefore, Jimmy is…

Q: How many rows are in a truth table with 5 input variable

A: Actually, given information regarding: truth table with 5 input variables.

Q: For the data given below, find the best-fitting line (according to the criteria of the…

A: Instruction: linear fit {1, 1.2},{2, 2.3},{3, 3.6},{4, 4.9},{5,5.9} Screenshot:

Q: unique answer only

A: LOGIC DIAGRAM: Given the associative law as x.(y.z) = (x.y).z. Now, the following is the…

Q: 22 32 36 35 41 56 34 29 24 30 30 25 29 32 24 find One-way ANOVA (One-way analysis of variance)

A: your question is about finding one-way ANOVA. let's see the solution of the question

Q: Do any of the Thirteen l's seem contradictory? If so, why?

A: Rule 1 "I will own the issue" and Rule 11 "I will get another viewpoint" are contradictory in the 13…

Q: Make a truth table for P or not q What is your last column answer(read from top to bottom)?

A: Make a truth table for P or not q

Q: Use a membership table (Truth Table with Ones(1) and Zeroes(0)) to show that A ∩ (B ∪ C) = (A ∩ B)…

A: Membership Table: It is a table displaying the membership of an element in set. It indicates…

Q: Simplify na(pv-p) to n

A: n∧(p∨¬p) = n ∧ T [ from Complement law: (a∨(¬a))=T ] = n [ from Identity law: (a∧T)=a ] Hence it is…

Q: Create a 10 random data set using rand syntax in scilab. Solve for the first 5 order of moment both…

A: Code: x=100*rand(10,1)muX=mean(x);n=10; //Function that defines the rth moment about the…

Q: Use your understanding of the word or to complete the truth table for disjunction, as shown.

A: Disjunction: Disjunction is referred to as a compound statement, which is formed by joining two…

Q: Evaluate the following expressions in MATLAB, where t = 8 s, i = V-1, and w = 160n rad/s. (Enter…

A: a) 1.1254e-07 + 0 i b) 1.1254e-07 - 1.7640e-20i c) 1.1254e-07 - 1.7640e-20i d) The real part of the…

Q: Minimize the given below DFA using Myhill-Nerode theorem/Table filling method [All steps should be…

A: Answer-

Q: 10 1 22 43 4 34 2)

A: Using Quadratic probing in hash table

Q: What’s does the Welch’s t test result means for two different groups? Welch’s t test result =…

A: The two-sample t-test (also known as the independent samples t-test) is a method used to test…

Q: Write a compare-contrast table (use point-by-point method) on the following: 1. Iconic and Canonic…

A: 1. Iconic and Canonic design 2.Deductive and Inductive arguments. Here,we have to compare between…

Q: Correlations are distorted if the data is standardized. True False

A: The answer is given in next step

Q: Given a truth table below with the first two columns of truth values provided: f(p,q) T. T F .? 3. T…

A: The truth table for the given question is as follows:

Q: Arthemetic mean is 32 and standard deviation is 24 then value 70 is transformed , what is that value…

A: - We need to highlight the transformed value from the arithmetic mean, standard deviation and the…

Q: Use a truth table to determine if the following is a logical equivalence: ( q → ( ¬ q → ( p ∧ r )…

Q: Any DFA is an NFA and therefore is also a Generalized NFA (GNFA) Select one: True False

A: DFA = In a DFA, for each state, there needs to be a transition arrow for all possible elements in…

Q: 1. Draw e-NFA using Thompson Construction from regex below : (100|11)* 1 0* а. b. a*b (ab|baa)?

A: Actually, NFA stands for non-deterministic finite automata. It is a easy construct than DFA.

Q: Convert the resulting NFAs of question 3 into DFAs using techniques a) a(b|a*)a* b) (a*|b*)a*b*

A: The above question is to convert the resulting NFAs for the given regular expressions into DFAs. The…

Q: normalization is and its different forms.

A: normalization and its different forms.

Q: the present continuous can used with a planned future arrangement true False

A: Present continuous is a form of tense.

Q: A correlation coefficient equal to means 100% correlation in the opposing sens O -100 O 1

A: Correlation is the measure of extent into which the changes in the values of two or more variables…

Q: At first calculate the equation and get the set for your question: 1) take your Stud ID number, 2)…

A: PROGRAM CODE: #include <stdio.h> // include header file for standard…

Q: Which of the follwings are true? (There might be multiple correct answers) Compare and swap is a…

A: As per our guidelines we are supposed to answer only one question. Kindly repost other questions as…

Q: Question 1 for f(t) = t", use loop statement in Matlab to get the summation of f(t) at t=2 and n…

A: Hello student Greetings Hope you are doing great. As per our policy guidelines in case of multiple…

Q: Give unsigned compare conditions between two variables i.,e (i - j)?

A: The Answer is in below Step:-

Q: Question 6-Create a chart depicting order count datewise. Empl Rcd# ID 311587 645109 645109 835119…

A: The given excel data is :

Q: Any DFA is an NFA and therefore is also a Generalized NFA (GNFA). Select one: True False

A: given, Any DFA is an NFA and therefore is also a Generalized NFA (GNFA). We have to tell whether it…

Q: Add synchronizing tables to the predictive parsing table.

A: The Answer is

Q: Make a truth table for given statement: not p or q A. TFTT B. TTFF C. FTTT D. NONE OF THESE ANSWERS

A: given, not p or q

Q: Rearrange tNe diagram DETOW to get the Tollowing figure for N rows 1 3 2 5 4 start No Yes End No Yes

A: This question comes from Flowchart in programming which is a part of Computer Science. Let's discuss…

Q: Given a truth table below with the first

A: The truth table is given below

Q: Given the following confusion matrix, calculate the False Postive Rate for B. FPR of B = ACTUAL…

A: For the given matrix, we need to calculate false positive rate for B. We know that, False Positive…

Q: Q2: Give an example and the result for using the following tools: 1- "clear" 2- "sqrt"

A: clear() function is used to remove all the elements of the vector container, thus making it size 0.…

Q: What is the the correct sequence to activate the subplot 'N Sin' in the following diagram? Cos Sin…

A: Subplot in python : In python, multiple plots can be created in the same plot which is displayed in…

Q: Given the Sailor, Boat, and Reservation tables. Sailor Table Reservation Table ID (PK) NAME RATING…

A: SQL Query: SQL query is used to create and manipulate data in the database. Join: Join is used to…

Q: Write 10 physical significance of full subtractor

A: The physical significance of a full subtractor are as follows: These are important for the…

Q: Minimize the given below DFA using Myhill-Nerode theorem/Table filling method [All steps should be…

A: Minimization of DFA is required to achieve the simplest and most equivalent version of any DFA with…

Q: Get 1 script for local and global alignment till the traceback, best alignment and the best score.…

A: Alignment on a Local Level• Make the first row and column 0 by default.• The best local alignment…

Q: Rational sub-groups usually work best using samples of consecutive measurements over a short period…

A: Lets see the solution in the next steps

Q: What is the Jaccard similarity coefficient between these two phrasess: 1; "Flower Busket" and 2:…

A: Answer to the above question of Jaccard coefficient is in step2.

Q: Complete the truth table by filling in the required columns. p q ~p q-> ~p ~(q-> ~p) T T…

A: According to the information given:- We have to fill the blanks of the mentioned truth table.

Q: Part 1: Truth Tables (1a) Provide complete truth tables for each of the following 1. ¬ (P ∨ Q) ∨…

A: 1. for evaluate the expression use the variable to generate T or F like For A and B Then use…

Question

i have here algorithm multi choice questions please

How many comparisons needed to find the first match of the following text and pattern using Boyer
Moore, T= "ABACBCACABBA" and P="ABBA"
Select one:
O a. 8
O b. 12
O c. 3
O d. 6

The space complexity of assignment job problem is
a. O(n?)
O b. O(Log n)
O c. O(2")
O d. O(n!)

Process or set of rules that allow for the solving of specific, well-defined computational problems through a specific series of commands. This topic is fundamental in computer science, especially with regard to artificial intelligence, databases, graphics, networking, operating systems, and security.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Bad Match Table

VIEW

Comparisions

VIEW

Assignment Job Problem.

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

Rename the EMPLOYEES table as JL_EMPS.
Correct and detailed answer will be Upvoted else downvoted. GNF
Part II: Complete the following exercise: Using your student table select all students that have a last name of “Parker” and have a first name that starts with “S”. Order your results by state. Using your student table select all students with ZIP codes between “23164” and “98164”. Using your student table select all students where states are in Florida and New York. Using your student table select all students where the last name starts with an “S” and is at least three characters in length.
The following table is in 1NF. Convert it to 2NF using proper notation:Facilitator (FacilitatorID, LastName, FirstName, Street, City, ZipCode, (ForumNum, ForumDate, CustomerNum, LengthOfForum, PresentationCode))
Explain formula used to calculate BMI and category column and also do all other steps given in picture.
Apply the INGRES algorithm (the detachment technique) to the following query: Select std_name,std_dpt FROM std_info,std_absence WHERE std_info.std_id%3Dstd_absence.std_id AND std_absence.abs_hrs > 1 AND std_absence.date = '2020-12-06'; std_info I std_id ! std_name ! std_dpt I std_avg ! 1 1 Ahmed 2 I Ali ! Information ! I Networks 75 1 80 : std_absence | std_id : std_name : date I abs_hrs I 1 ! Ahmed 2 I Ali 1 1 Ahmed | 2020-12-06 1 | 2020-12-06 I 2020-12-08 I
Using the STUDENT table structure shown, do the following: Attribute Name Sample Value Sample Value Sample Value Sample Value Sample Value INV_NUM 211347 211347 211347 211348 211349 PROD_NUM AA-E3422QW QD-300932X RU-995748G AA-E3422QW GH-778345P SALE_DATE 15-Jan-2018 15-Jan-2018 15-Jan-2018 15-Jan-2018 16-Jan-2018 PROD_LABEL Rotary sander 0.25-in. drill bit Band saw Rotary sander Power drill VEND_CODE 211 211 309 211 157 VEND_NAME NeverFail, Inc. NeverFail, Inc. BeGood, Inc. NeverFail, Inc. ToughGo, Inc. QUANT_SOLD 1 8 1 2 1 PROD_PRICE $49.95 $3.45 $39.99 $49.95 $87.75 A. Write the relational schema, draw its dependency diagram and identify all dependencies, including all partial and transitive dependencies. You can assume that the table does not contain repeating groups and that any invoice number may reference more than one product. (Hint: This table…
For questions 4 and 5, use the following order for the rows in your truth tables.P QT TT FF TF FP Q RT T TT T FT F TT F FF T TF T FF F TF F F4. (8 marks) Construct truth tables for the following statement forms.In your truth table, make sure that you include a column for each intermediate expression that you evaluate on your way to your final answer.(a) (P ↔ ¬Q) ∧ (P ↔ Q)(b) (¬P ∨ (¬Q ∨ ¬R)) ∨ (P ∧ Q)
Q9) find the least expensive priceQ10) List the UNIQUE v_code of vendors that provide productsQ11) find the most expensive priceQ12) List the number of products by vendor with the average price, include only the rows withaverage price below 10.00Q13) List all vendor rows (including the ones that have no matching products) and all matchingproduct rows
Apply the INGRES algorithm (the detachment technique) to the following query: Select std_name,std_dpt FROM std_info,std_absence WHERE std_info.std_id%3std_absence.std_id AND std_absence.abs_hrs > 1 AND std_absence.date = '2020-12-06'; std_info I std_id ! std name i std_dpt I std_avg 1 | Ahmed 2 i Ali ! Information ! I Networks 75 80 : std_absence | std_id : std_name : date I abs_hrs! 1 ! Ahmed 2 I Ali 1 ! Ahmed | 2020-12-06 1 | 2020-12-06 | 2020-12-08 I
WEEK 9 ASSIGNMENT#6 Part II: Complete the following exercise: Using a subquery, select student first name where the student is in the student course table. Using a subquery, select the course id where the average GPA is 2. Using a subquery, select the course id where the average GPA is greater than 2. Using a subquery, select student first name where the student is not in the student course t
For reading order as a functional test for summarization, fill in the rightmost two columns of the table below. Which Summarizer is the best of the 5 shown, and why? Document Set Document Order Weighted Distance to Original Ranked Order Original ABCDEFGHIJ N/A N/A Summarizer 1 ABFDECHIGJ Summarizer 2 ABCIEHJDGF Summarizer 3 ABDCFEHIGJ Summarizer 4 BACEDGFIHJ Summarizer 5 ADCFEBIGHJ