● ● How is relation How is

Q: Define autonomic nervous system (ANS)

A: The nervous system is the central processing unit of the body. It enables us to perceive and respond…

Q: Are there living beings without cells?

A: Cell is considered as the basic structural and functional unit of living organisms. eukaryotes are…

Q: 3. Which of the following does not describe the central nervous system? contains the brain and the…

A: The nervous system is the body's primary system for communicating and controlling. Every idea,…

Q: 95. Which of the following could play a major role in the entry of a ligand into an animal cell?…

A: Ligands are signalling molecules that enters the cell as an initial step of a complex pathway.The…

Q: What is the function of the cell membrane? To control the substances that enter and leave the cell O…

A: Introduction :- The cell membrane, also known as the plasma membrane, is found in all cells and…

Q: What are the limitations of the cell theory?

A: Cell is main structure in the body level of organizations . On the basis of cell type , it is…

Q: O All cells have the same organelles. O Living cells come from other cells. O All living things are…

A: 1. Living cells come from other cells.  2. All living things are made of cells.

Q: What component serves as the receptor? What component serves as the control center? What component…

A: Homeostasis is body's ability to adjust it's internal environment for the maintainence of optimal…

Q: Can you please solve part d and e?

A: Neurons are the smallest structural and functional unit of nervous system. These are responsible for…

Q: xplain what purposes various cell connections serve

A: The cells are tightly pack together by various types of specialised cell junctions or connections.…

Q: Which types of light cause damage to genetic material? (SELECT ALL THAT APPLY) ultraviolet visible…

A: ANSWER;- a) Ultraviolet light causes damage to genetic material. Explain;- DNA can be harmed when it…

Q: How are comunities distinguished?

A: A place where biotic as well as abiotic factors live together in harmony and interact with each…

Q: Helping tags: Biology, Regeneration, Plasticity . . . . . 1. WILL UPVOTE, just pls help me answer…

A: Since you posted multiple questions we will solve first question for you. Kindly repost other…

Q: ID the blue region at the white tag

A: A single celled zygote undergoes multiple rounds of cell division, also known as cleavage process in…

Q: Potentiality or property of cell to produce a whole organism is called as Which of the following…

A: Cell is principal unit of life .It provide support , energy to the body and carry out various life…

Q: n frogs, the segregation of ocular input to the tectum is mediated by eceptors and occurs AMPA;…

A: Like many animals, frogs largely rely on their vision to find their way about and find prey. Their…

Q: Which maintains homeostasis for the cell by regulating the movement of substances into and out of…

A: Homeostasis can be defined as the ability to maintain the relative stable internal state that…

Q: Short term control mechanisms are implemented by the ........system, while long term mechanisms are…

A: Blood is a body fluid that transports necessary substances, nutrients, hormones, and oxygen to the…

Q: Does the nonlinearity of biological systems make it impossible to do large-scale biological…

A: Biological Engineering is an interdisciplinary area focusing on the application of engineering…

Q: Where would it be most likely to find cell bodies of neurons in your own body? brain O thigh all of…

A: The cell body of a neuron consisting of the nucleus and the lysosomes. It is where synthesis of…

Q: What are dynamic structures that can assemble ordisassemble rapidly at their ends. Their lifetimes…

A: Microtubules like actin filaments are the dynamic structures that can assemble and disassemble…

Q: Pick and define two terms that  use to describe the various proteins/enzymes or cellular processes…

A: "Transcription" and "Translation" are two words that are frequently used to refer to proteins,…

Q: What are the advantages of using many varied methods to connect structure and function in cells?…

A: Cells are important elements of living. Every living thing is composed of cells. This structural and…

Q: Which of the following statements about DNA are true? (choose all that apply) O It is a polymer…

A: An organelle is a subcellular structure that has one or more specific function to perform in the…

Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of…

A: Introduction The cell is life's most fundamental structural and functional unit. Cells are the…

Q: Why and when does non-linearity lead to chaos in biological and mechanicalsystems?

A: Non linear system is that system in which the change in the output is not proportional with the…

Q: Describe the following:(a) synapsis (b) bivalent (c) chiasmataDraw a diagram to illustrate your…

A: Cell division by meiosis takes place in two parts: Meiosis I and II. Meiosis I is similar to mitotic…

Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: light-pupil system

A: Nervous system: This system includes the brain, spinal cord, and a complex network of nerves. This…

Q: Phylum, genus, and name of purple elongate structures shown here? Phylum? Genus? Name of purple,…

A: Bryophytes are the simplest and primitive, non flowering, embryophytes, that do not contain vascular…

Q: QUESTION 1 Inhibitory local, inhibitory distant, excitatory local, excitatory distant and…

A: Neurons These are nerve cells and are the basic unit of the brain. These cells use electrical and…

Q: Fluorescent FM dyes partition reversibly into biological membranes without penetrating through them.…

A: The fluorescent FM dyes can't pass through biological membranes as they are membrane-impermeable…

Q: What are heterochromatic and euchromatic regions.?

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…