How are squalus (shark) brain and sheep brain similar and different? Please avoid copying the previous answer in bartleby. a. Similarities: ? b. Difference: ?
Q: Describe the role of Ras.GTP and Rac.GTP in the formation of active AP-1 during T-cell ww ww…
A: Ras GTP and Rac GTP falls under the Rho family GTPase proteins, that play the key regulatory role in…
Q: Acetylcholine is released by from the synaptic cleft at a postganglionic neurons and is removed rate…
A: Answer :- Option (B) is correct. - Acetylcholine is released by parasympathetic phostganglionic…
Q: How did the first cell membranesarise?
A: The import and export of metabolite and polymers is regulated by cellular membranes, which are…
Q: MSA/mannitol salt agar plate is selective because: O it allows only gram positive bacteria to grow O…
A: Mannitol salt agar(MSA) It is a selective medium used for the isolation, enumeration and…
Q: A second action potential can be initiated: When both activation and inactivation gates of the Na+…
A: Action potential: When the membrane potential of a given cell location rapidly rises and falls, an…
Q: Nature Picture Library Aristolochia old stem, x.s. Berkshire Community College Helianthus stem, x.s.
A: 2. Aristolochia young stem : The herbaceous dicot stem. Leaf promordia which are horns on the…
Q: The accoumulation of higher levels of mercury in large predatory fish is a result of? A. Genetic…
A: Biomagnification is the buildup of a chemical by an animal as a consequence of water and food…
Q: New genetic variations may occur because of (Check all that apply) Select 3 correct answer(s)" A)…
A:
Q: The pinna:
A: The question is based on sense organ ear.
Q: Draw and describe the different types of egg as to the concentration of yolk they contain. Give…
A: Almost all the female animals lay eggs of various species, such as birds, reptiles, amphibians, a…
Q: The medical practice you're working for testing an average of 22.4 patients a day for the past 3…
A: Medical practice: A sole proprietorship, a partnership, an association, a professional corporation,…
Q: 1. How muscles and joints work together
A: muscles are connected to bones by fibrous bands known as tendons. these provide stability and allow…
Q: Question 3 RNA polymerase can still transcribe a gene if LoxP sites and a stop cassette are inserted…
A: RNA polymerase is the enzyme that helps in the initiation of the transcription. These enzymes are…
Q: Second letter UUU UCU UCC UAU UAC UGU Tyr Phe UUCJ UUA UUG. UCA UCC Ser UAA Stop UGA Stop A UAG Stop…
A: 1)Codon on mRNA strand which codes for Methionine is AUG from 5' to 3' direction. This is an…
Q: How much more Rohydraloxide does it take for the rats to have a 50% probability of death if the rat…
A:
Q: 2. How have new technologies, such as DNA analysis and biochemical tests changed the way organisms…
A: Given: The hierarchy of classification suffers from its own disadvantages when only the physical…
Q: The following factors differentiate the two forms of relapsing fever EXCEPT A. Type of vector B.…
A: There are few important points : Any organism that causes a disease is pathogen and its ability to…
Q: Which of these fundamental concepts is well illustrated by genetic exchange among, but distinct…
A: Evolution is the change in the specific features of a species over several generations and depends…
Q: Tabulate the differences between prokaryotes and eukaryotes.
A: The cell is the smallest structural and functional unit of the organism. Depending on the nature and…
Q: Name four differences between the structure of DNA and RNA.
A: Introduction :- Ribonucleic acid (RNA) is a nucleic acid found in all living cells that is…
Q: Which of the following nutrients is critical for a toddler's nervous systems development? A. Sugar…
A: The formation of your baby's brain is a complicated process that occurs throughout your pregnancy.…
Q: What are the processes of the photochemical stage of the photosynthesis process?
A: Introduction :- Plants take in carbon dioxide (CO2) and water (H2O) from the air and soil during…
Q: All of these characteristics of P. aethiopicus suggest that it may represent an evolutionary…
A: Paranathropus is derived from a greek work, in which "para" means near and "anthropus" means man,…
Q: What does research suggest about regular physical activity's effect on the life span? A. Consuming…
A: Introduction Life expectancy is a statistical measure of how long an organism should live depending…
Q: ABSOLUTE HUMIDITY 1. the amount of water vapor in grams per cubic meter of air at a given…
A: Absolute humidity (measured in grammes of water vapour per cubic metre of air) is the amount of…
Q: Dose standardization is best done by A all of the above B age C weight D height
A: 11. Many pharmacological dosage criteria have been proposed based on age, weight, and surface area,…
Q: The following statements about the 'membrane attack complex' (MAC) is incorrect. Explain (i) The…
A: Introduction :- The membrane attack complex (MAC) or terminal complement complex (TCC) is a protein…
Q: Please associate the source of energy production with the major by-product created for each source…
A: A human body requires an adequate amount of nutrition so as to function properly. The human body…
Q: Explain how the sequence of a molecule of DNA, made up of many monomers of only four possible…
A: DNA is an organic molecule that includes genetic data as well as guidelines for protein creation. It…
Q: Ir Semitend Sem eanoeus
A: Answer pig bones labelling
Q: differentiate between totipotent and multipotent
A: Introduction Stem cells:- These are the body's raw materials and are able to develop into many…
Q: Q5. Based on the data in the table below, which of the following most likely correctly identifies…
A: Nutrients are required for the proper growth and development of the organism. Some nutrients are…
Q: How does oviposition occurs in female turtles. Provide the pathway involved in the oviposition…
A: Answer :- As we know that Males have a couple of penises that pass sperm from their cloaca to the…
Q: Explain how the functions of DNA emerge from the structure of its monomers and its antiparallel,…
A: DNA is a long deoxyribonucleotide polymer. The amount of nucleotides (or base pair of nucleotides)…
Q: The cells that are found in tendons are called: A. osteocytes B. adipocytes C. haemocytoblasts D.…
A: tendons connect muscle to the bones. It is a fibrous connective tissue.
Q: The sandwich type of ELISA detects patient antibodies to an antigen.
A: Antigen and antibody reactions are specific. The epitope of the antigen binds to the paratope of the…
Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…
A: The process of protein synthesis involves two major steps - Transcription Translation During…
Q: How does capillary electrophoresis differ from gel electrophoresis? a) The capillary system can…
A: Gel electrophoresis is done in a vertical or horizontal plane with a polymeric matrix of…
Q: RELATIVE HUMIDITY 1. the amount of water vapor in grams per cubic meter of air at a given…
A: Humidity is known as the presence of water vapor in the atmosphere. This is measured by an…
Q: Explain delayed type hypersensitivity (DTH). How might you expect to induce it? What components of…
A: The delayed type hypersensitivity (DTH) is characterized by the T cells recruitment into tissues to…
Q: indicate if TRUE or FALSE 1. Cactus is an inhibitory protein.
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Development of insects are affected by many factors. Cite three major influencers and state how they…
A: Insects are the class of organisms that belong to the Phylum Arthropoda. Like any other Arthropod…
Q: What do you think would happen to the cell cycle of cells that contain a point mutation in the S-…
A: Cyclin and cyclin dependent kinase play a very important role in the progression of cell cycle. Cell…
Q: dysregulation/impaired function for each of these. Hypothetically, how can you rescue the…
A: G protein coupled receptors is a trans membrane domain of 7 helix meaning that they cross the cell…
Q: 16.In what order do sperm move through the structures of the female reproductive tract? (This is a…
A: Reproductive System: The biological system of an organism's reproductive system, also known as the…
Q: Which of the following is NOT a recommended method for preventing cross-contamination? A. Washing…
A: Cross contamination Cross contamination is physical transfer or movement of pathogens from one…
Q: HIGH TEMPERATURE AND LOW HUMIDITY - BODY EFFECTS 1. dry mucous membranes 2. hyperthermia 3. abrupt…
A: Temperature is a physical quantity that conveys heat and cold as well as a measure of the average…
Q: In which of the following events would carbohydrate loading NOT be beneificial? A. Weightlifiting…
A: Carbohydrate loading is a strategy generally used by endurance athletes. This is done to increase…
Q: What is the main function of the Liver of the frog
A: Frogs are predatory, tailless amphibians widespread throughout India. Frogs come in a wide variety…
Q: How does mutation can affect the central dogma and the phenotype?
A: Mutations are the changes in the DNA sequence. The changes can be single base changes or a fragment…
How are squalus (shark) brain and sheep brain similar and different? Please avoid copying the previous answer in bartleby.
a. Similarities: ?
b. Difference: ?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What are the different regions of the cat’s brain? Briefly describe each. Tabulate your answersbelow. Use images or illustrations to complement your answer.Give typing answer with explanation and conclusion The "laminae of Rexed" refer to: a. parts of the cerebral cortex stained by the Nissl method b. territories of the spinal cord gray matter stained by the Nissl method c. layers of the thalamus stained by the Nissl method d. none of the aboveI need help finding a research paper and a news article that evaluates how brain and mind are presented outside the scientific literature. Specifically, you’ll choose an empirical study (2020 or earlier) that was featured in news reports and critically evaluate its presentation there in light of the original research paper. The topic is about visual perception in animals or humans . We already spoke about mantis shrimp so that example is not available however it can be any other animal.
- What is hypermnesia? A. when children are asked the same question a second time after a delay, they produce more accurate information B. a type of amnesia in which memory loss occurs at a rapid rate C. amnesia associated with people with Alzheimer’s disease D. the idea that adults have more memory storage than childrenWhat is “hot cognition”? a. The notion that juveniles are more likely to exercise poor judgment as a result of peer pressure or when facing stressful situations b. Neuroscience research on brain imaging on youths c. The notion that adolescents’ intelligence and ability to reason is similar to that of adults by the age of 16 d. Both a and c, but not bList and explain the added advantages of multivariate analysis over bivariate analysis.
- What is the semantic category approach? What do the results of Huth’s imaging experiment in which participants had their brain scanned while listening to stories indicate about how concepts are represented in the brain?What is projected to happen to the number of people with Alzheimer's disease and the number of people over age 65 in the United States over the next 40 years? b. Based on the information provided, can you think of an explanation for the trends identified in the question above? a.Waugh and Norman argued that the Brown Peterson task was flawed and created a new experiment. Which of the following conclusions was supported by the results of their experiment? 1. Duration of short-term memory is about 16 seconds. 2. Capacity of short-term memory is about 16 items. 3. Forgetting from short-term memory is due to decay, not interference. 4. Forgetting from short-term memory is due to interference, not decay.
- The right hemisphere is only engaged in left hemisphere is more engaged in while the a.forming distant linkages; determining the meanings of certain words. b.determining the meanings of certain words; forming distant linkages c.implication; drawing inferences. d.drawing inferences; implicationDescribe brain imaging evidence for localization of function. Describe experiments thatinvolved looking at still pictures and that involved looking at movies. What does eachtype of experiment tell us about localization of function?Please answer 3) The gustatory cortex is in the: a) temporal lobe and interpretes auditory patterns. b) parietal lobes and is important for the sense of taste. c) frontal lobe and helps control muscles of speech. d) occipital lobe and recognizes visual patterns.