Q: How mitotic crossing-over can contribute to cancer
A: Cancer is defined as the biological disorder in which the cells undergo uncontrolled growth and cell…
Q: The chromosome are arranged to show
A: A karyotype is a complete picture of the chromosome set of an individual. For example, a human has…
Q: Why if cancer occurs in any part of the body, it is difficult to grow in the spleen, muscle, small…
A: Cancer cells are the type of cells that loses their control over growth and form lumps of cells…
Q: Differences between human male and female chromosomes.
A: Chromosomes is thread like structure in shape which is present in the nucleus and contain DNA Genes…
Q: True or false: When oncogenes are present, a cell is more likely to be normal (non-cancerous) than…
A: The normal growth and functions of human cells are primarily based on the information stored in each…
Q: (X)
A: Mitosis is the division of a single cell into two daughter cells that are similar (cell division).…
Q: why Triploid Organisms Are Usually Infertile
A: Triploid organisms can occur naturally or can be created by genetic modification. Triploids are…
Q: Identify the parts on the picture at the top. [ DNA, Chromosome, Tumor Suppressor, Proto-Oncogene,…
A: * Chromosomes are thread like structures which can be found inside the nucleus of animal and plant…
Q: All nucleated cells in the human body, except the reproductive cells, have ___________ pairs of…
A: The cells in the human body can be divided broadly into two categories: somatic and germ cells. Germ…
Q: true or false Different cell types develop in a multicellular organism because each cell has its own…
A: Multi cellular organisms are organisms that are made up of more than one cell. This is in contrast…
Q: In Many Organisms, why Organelles and TheirDNA Are Inherited from One Parent
A: The extrachromosomal DNA present in the cellular organelles is also called cytosolic DNA since the…
Q: Genetic marker systems
A: The nucleotides sequence in DNA or RNA is called a gene. This sequence is capable of synthesizing…
Q: How meiosis contributes to genetic diversity
A: Meiosis is a special type of cell division that occurs in sexually-reproducing organisms and used…
Q: student groups different types of cells as shown. Up Cell 1. 2. Турes Compari son
A: Cell is the basic structural, functional, and biological unit of all known organisms. The cell…
Q: In which stage of karyokinesis of mitosis nuclear formation and movement of asters towards the…
A: Nucleus is one of the structures present in a cell that holds the genetic content of the cell. The…
Q: Why DNA copy is important for reproduction
A: Introduction Cells is the main fundamental unit of life. Every organism be it unicellular or…
Q: "morphogen"
A: Morphogen is a protein which is a signalling molecule that helps in formation of organs…
Q: True or False: Every chromosome carries exactly the same information.
A: A chromosome contains all the genetic information. Most of the chromosomes present in the eukaryotic…
Q: The number of chromosomes present in a nerve cell of a human being.
A: The number of chromosomes in human body is 23 pairs or 46. Out of which 2 are sex chromosome and…
Q: A person known to be born with one X-chromosome, zero or no known Y chromosome, trisomy 21, and…
A: Introduction Most of the organisms present on earth are diploid which means they contain two sets…
Q: give the importance of having these checkpoints in the specific phase of the cell cycle in 5…
A: Each step of the cell cycle is monitored by internal controls called checkpoints. There are three…
Q: Define the stage of cell division.
A: TELOPHASE It is the final stage of mitosis . The process occuring here is the reverse of what…
Q: Henrietta Lacks was female, so, naturally, all the cells from her derived cancerous cell line have…
A: Females have XX chromosomes and males have XY chromosome.
Q: how ctDNA can be early detector of cancer
A: A tumor is considered an abnormal growth of tissues in the body. The tumor can be cancerous, if it…
Q: What is born Cancer
A: Since there is nothing called born cancer, we are assuming that you wanted to ask about bone cancer…
Q: A reciprocal translocation between chromosomes9 and __ contributes to chronic myelogenous leukemia.
A: Step 1 Introduction Translocation is a type of chromosomal aberration in which two non-homologous…
Q: Cancer occurs when genes that regulate the cell cycle are mutated. True False
A: Cell cycle is a kind of division which produces daughter cells from the parent cell.
Q: cell cycle stage
A: The cell cycle consists of four phases that is G1, S, G2, and M. The S phase or the synthesis…
Q: Loss of heterozygosity of tumor suppressor gene_______________
A: Loss of heterozygosity -It is the loss of one parent's contribution to cell and can be caused by…
Q: Nucleus -Barr bodies The figure represents the stained nucleus from a cheek epithelial cell of an…
A: Barr body: it is defined as a condensed X chromosome which is stained densely and inactivated. It is…
Q: Statement 1: Embryonic stem cells are pluripotent which means that they are capable of…
A: Stem cells are characterized by the ability to form functional tissues, replicate indefinitely, as…
Q: Chromosomes and Genetics
A: Characteristic traits from a generation to next generation is passed through the gene. Some…
Q: his area of the chromosome iIS 5%.
A: Introduction Linkage disequilibrium (LD) is the nonrandom relationship of alleles of various loci.…
Q: A substance or an agent in the environment that increases the chance of genetic alteration and…
A: Answer Malignant tumor
Q: how to deal with a high incidence of cancer in the area of your state where heavy industry is…
A: Cancer is a group of disorder. It is characterized by abnormal growth of the cells in the body. This…
Q: Homologous chromosomes
A: One homologous chromosome is inherited from mother and one is inherited from father.
Q: how Mistakes during mitosis can generate clones of aneuploid cells.
A: Mitosis is a type of cell division which occurs in somatic cells. The parent cell divides into 2…
Q: How many chromosomes a female human cell will have after mitotic division.
A: Mitosis: - in this type of cell division the ploidy of parent and the daughter cells remain the…
Q: Five differences between Mitosis and Meiosis
A: Mitosis and meiosis are two types of cell division that can be characterized by changes that take…
Q: How did Peyton Rous prove that transmission of the tumor was through a virus?
A: By connecting with host proteins, growing while the human immune system is weakened, and hijacking…
Q: The importance of having these checkpoints in the specific phase of the cell cycle. 10 sentences
A: Transformation of cells from one phase of the cell cycle to another is controlled by some external…
Q: 6. Nucleus 7. Chromosome 8. | DNA 9.
A: DNA stands for deoxyribonucleic acid, which is a molecule that contains the instructions an organism…
Q: To determine: The errors in the cell cycle that affect humans by causing cancer.
A: Mitosis is a cell cycle, equational division. Mitosis occurs when a somatic cell divides into two…
Q: Which correctly described cytokinesis and the phase it occurs in the cell cycle
A: Cytokinesis: cytokinesis happens once mitosis, during which the cytoplasm is split into 2 daughter…
Q: Please tell me more about mitosis
A: During the cell division, the mitosis is an important stage in which the replicated chromosomes are…
Q: Why gametes have a haploid number of chromosomes.
A: The number of complete sets of chromosomes is more specifically known as the ploidy of a cell. In…
Henrietta Lacks was female, so, naturally, all the cells from her derived cancerous cell line have _______ chromosomes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- OHHH HHHH H H H HH -с-с-с-с-с-с-с-с-с-с-с-с-с HH H H H H H H H HHH H H H H H H H HHH H-C-O C-C- OH H H H H H H H H-C-0 C-C-C-C CH, H H H,CN-C-c-o-P-0-c-H CH, H H H H H H H H H c-c-c-o What do you call the structure enclosed in the rectangle? What type of chemical bond is represented by the structure with an arrow?. What structure does the bond identified in # 2 create in relation to the entire molecule shown? True or False: This molecule is non-amphipathic. (True or False) I-0-Itus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letterWhy was blood glucose measured?