Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Related questions
Question
Heapsort analysis
in python or java implement the Heapsort
Run the implemented algorithm for the best case and display the number of operations performed.
Run the implemented algorithm for the worst case and display the number of operations performed.
You must implement the algorithm, do not use a pre-implemented function.
Thanks in advance!
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 5 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACTarrow_forwardPersonal project Q5. This question is concerned with the design and analysis of recursive algorithms. You are given a problem statement as shown below. This problem is concerned with performing calculations on a sequence ? of real numbers. Whilst this could be done using a conventional loop-based approach, your answer must be developed using a recursive algorithm. No marks will be given if your answer uses loops. FindAverageAndProduct(a1, ...., an) such that n > 1 Input: A sequence of real values A = (a1, ..., an) Output:, A 2-tuple (average, product) containing the average (average) of all the values and the product (product) of all the values of the elements in A. Your recursive algorithm should use a single recursive structure to find the average and product values, and should not use two separate instances of a recursive design. You should not employ any global variables. (a) Produce a pseudo code design for a recursive algorithm to solve this problem. (b) Draw a call-stack…arrow_forwardCan you please also explain what are the differences between the two algorithms?arrow_forward
- binary search c++ recursivearrow_forwardCount divisibles in range def count_divisibles_in_range(start, end, n): Let us take a breather by tackling a problem simple enough that its solution needs only a couple of conditional statements and some arithmetic, but not even one loop or anything even more fancy. The difficulty is coming up with the conditions that cover all possible cases of this problem exactly right, including all of the potentially tricksy edge and corner cases, without being off-by-one. Given three integers start, end and n so that start <= end, count how many integers between start and end, inclusive, are divisible by n. Sure, you could solve this problem with the list comprehension one-linerreturn len([x for x in range(start, end+1) if x % n == 0]) but of course the automated tester is designed so that anybody trying to solve this problem in such a blunt fashion will only find themselves running out of both time and space! Your code should have no loops at all, but use only integer arithmetic and…arrow_forwardPython Big-O Notation/Time Complexity Pls answer only if u know big-o Thanks! Item #3.arrow_forward
- A hexagonal fractal pattern has the sequence {1, 6, 36, 216, …}. The recursive formula is ________.arrow_forwardThe following recursive definition of a set S over {a, b, c, d}. Basis: "", a, b, c E S. Recursive Step: If ax E S, then bax ES and cax E S. If bx € S, then cbx € S. If cx = S, then bax ES and bcx = S. If dx E S, then ddx E S. Closure: SE S only if it is a, b or c or it can be obtained from a, b or c using finitely many operations of the Recursive Step. a) What recursive step can be removed from the above definition and why? b) Derive from the definition of S that bcbc S. c) Explain why baa & S.arrow_forwardDesign and implement a recursive program(in java) to determine and print the Nth line of Pascal's triangle, as shown below. Each interior value is the sum of the two values above it. Hint: Use an array to store the values on each line.arrow_forward
- 1. A certain computer algorithm executes four times as many operations when it is run with an input of size n as when it is run with an input of size n – 1. Here, n > 1 is an integer. When the algorithm is run with an input of size 1, it executes 12 operations. How many operations does the algorithm execute when it is run with an input of size 5? How many operations does the algorithm execute when it is run with an input of size n?arrow_forward1) Design an algorithm using DFS that detects whether graph G has a cycle. State and explain running time. Graph G need not be connected. Write in Pseudocode, please. 2) BFS refresher: Suppose you have an n × n chessboard and a knight placed in one of the squares. Youwould like to find out the fewest number of moves needed to reach a given target square. Design an algorithmfor this task stated formally below: Input: An n × n chess board, a starting square S, and a target square T.Output: The fewest number of moves a knight takes to move from S to T. Write in Pseudocode, please.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill Education
Starting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSON
Digital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON 
C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSON
Database Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage Learning
Programmable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education