Q: Chose the right answer
A: The correct option is E . Cyclospora cayetanensis
Q: What level of structural organization is typical of a cytologists field of study
A: The question asks about the typical field of study of cytologist’ at the level of structural…
Q: True or False. Prokaryotes are classified as such because they are single celled organisms.…
A: There are two types of organisms. These are prokaryotes and eukaryotes. Prokaryotes are unicellular…
Q: Question 1 Bacteria Bacterial Morphology, prepared slide A. B. C.
A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…
Q: The classification of living organisms is a job that cannot be done by one individual and can never…
A: classification of organism -Each organism is different from all others to a lesser or greater…
Q: Rob knight Full transcript Write a summary on how our microbes make us who we are
A: A microbe, also known as a microorganism, is a microscopic organism made up of one or more cells…
Q: Please answer post lab question and give a conclusion about the experiment
A: Browning of potatoes is caused by the polyphenol oxidase enzyme. In the presence of oxygen, the…
Q: Why is Research is now an integral activity in the organizations?
A: Research is a study which is detailed and careful in order to find out more information about the…
Q: Write a short history about two personalities (alexdander Von Humboldt and Ernst Haeckel) and major…
A: Alexander von Humboldt He was born in 1769, Berlin, Germany. He was a very smart young boy so in…
Q: Please I did the differences between an electron microscope and a light microscope
A: According to the question, we have to explain the difference between an electron microscope and a…
Q: Bacteria are friends of man. Discuss.
A: The bacteria are single celled prokaryotic organism belongs to kingdom Monera. Bacteria include two…
Q: Defend this statement: “The investigations of Antoni van Leeuwenhoek changed the world forever.”
A: Anton Van Leeuwenhoek was born at Delft in the Netherland. He died at the age of ninety. He did not…
Q: Ms. Rossi, a third grade teacher who has been teaching for seven years, noticed that nearly half of…
A: During the scientific process, mindfulness is used to reach a logical and realistic conclusion.…
Q: As a medical practitioner, in the future, what is the importance of specimen collection being…
A: Specimen collection is the process of collecting biological samples. This includes a collection of…
Q: Can someone help with microbiology? I believe the top indicates a gram negative bacteria but the hue…
A: Gram-negative bacteria have a thin layer of peptidoglycan on their cell walls, but they also have an…
Q: SCIENCE
A: Dactylography is study of fingerprint , use this is important method of forensic science. Moisture…
Q: Which tool did Maurice Wilkins use when studying DNA? O electron microscope O X-ray machine O…
A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…
Q: Question 6 Describe what the Gram Stain shows: a. The organism is Gram Negative b. The organism is…
A: Introduction :- Bacteria are classified into two categories on the basis of the gram staining…
Q: Does the inventor intentionally or accidentally developed her AirDisc air-conditioner? What…
A: Maria Yzabell Angel Palma was in Grade 10 at the world class Philippine Science High School (PSHS)…
Q: How bacteria cells differ from human cells. Please give an example. Thank you!
A: Cells - Cell is the basic structural and functional unit of life. Cell is the basic unit of life in…
Q: Acknowledgements, recognitions, and awards of Antonie van Leewenhoek. What is/are his main…
A: Antonie van leeuwenhoek is a dutch microscopist;who done remarkable dicoveries in the field of…
Q: MICROBIOLOGY: Microscopic Morphology of Microbes (main topic) Write your introduction (This…
A: In a microbiology laboratory, the principle component to be used is the microscope. Dealing with…
Q: Louis Pasteur was
A: Vaccines are a suspension of weakened, killed, or fragmented microorganisms or toxins or of…
Q: I am doing my microbiology homework and I need help with these questions: 1) List the structures…
A: Bacteria are ubiquitous, mostly free-living organisms often consisting of one biological cell. They…
Q: As a future biologist, how important of you to master the skills of microscopy?
A: Biology is basically the study of living organism, their function in the environment and also the…
Q: What responsibility does the laboratory administra- tor have?
A: Laboratory administrators are in charge of the lab. Lab administrators have good leadership…
Q: Father of microbiology
A: Microbiology is the branch of Biology which deals with the study of microorganisms. As the name…
Q: Find 5 statements that Doug told Mary that are CORRECT.
A: In this scenario based on light microscopy. How to detect a specimen image through compund light…
Q: Can you talk to me about a scientist who advanced humanity's knowledge about tuberculosis?
A: The beginning of era of knowledge about Tuberculosis came from Robert Koch on March 24, 1882. He…
Q: State the similarity and difference between biology and philosophy. Express your answer in not more…
A: Biology is the study of life and living organisms, which includes their chemical processes, physical…
Q: ree things that you know about staining microbes? Why are staining techniques important to learn…
A: Gram staining could be a common technique accustomed totally differentiate 2 large teams of…
Q: Why was Van Leeuwenhoek's discovery of the unknown such a milestone achievement for the progress in…
A: Microbiology is the study of tiny micro where influence on the other living being and how they can…
Q: What are these two muhsrooms attached
A: Introduction Mushroom Is A Fungus. Some fungus develop a mushroom as a reproductive structure. They…
Q: MICROBIOLOGY: Microscopic Morphology of Microbes Write your introduction (This includes…
A: Microbes are vital to take care of the balance and traditional functioning of the Earth’s system and…
Q: Why was Van Leeuwenhoek's discovery of the unknown such a milestone achievement for the progress in…
A: Antonie Van Leeuwenhoek made single lens microscope on which he did his first observations of…
Q: the bacteria time to grow and reproduce for a period of time in ideal conditions
A: 2 -- colonize
Q: what is a microscopic organism that live in soil, water, organic matter or the bodies of plants and…
A: A microbe is a living entity that is so tiny that it cannot be seen with the naked eye. Microbiology…
Q: Watch the video and discuss the fundamental impacts of microbes on this planet. Which two items…
A: Microbes are the smallest life form existing on our planet. There are thousands of bacterial…
Q: Question 3 Which scientist is responsible for observing the first unicellular organism by looking at…
A: Biome is the largest ecosystem. Biome consists of aquatic and terrestrial ecosystems. The cell is…
Q: Greetings and thank you for your help Using 2 examples, explain how biology can be studied from a…
A: Biology is the study of life and living organisms.
Q: Discuss the differences between gram-positive and gram-negative cell walls. Why is this important…
A: Staining is a technique used in microbiology. In this process, the groups of microorganisms can be…
Q: Directions: Read and analyze the given question. Write your answer on your answer sheet. "Covid-19…
A: Corona virus disease 19 caused by corona virus , virus that belongs to family. causing common cold,…
Q: Alice Ball’s was contributions
A: Alice Augusta Ball was an African American chemist. During the year 20th century she developed an…
Q: Can you help me with CER (claim,Evidence,and reasoning) on the yeast fermentation lab for biology…
A: CER model explanation consists of claims: answers to a question. Evidence can be taken from…
Q: these are the other sub-parts to be solved I really need a good explanation for these questions…
A: Microbiology can be defined as a significant branch of science that deals with organisms such as…
Q: MICROBIOLOGY Read Unit 1 Chapter 1 and 2 (History and Scope of Microbiology) of…
A: Microbiology and human life Microbiology is found to be very much important in human life in a…
Q: MICROBIOLOGY: Microscopic Morphology of Microbes Write your introduction (This includes…
A: Discussion : Microbes : These are microscopic. single celled or multicellular organisms like…
Q: Answer True or False Dr. Soler would like to view the internal structure of the bacteria he was…
A: Microscope means the use of microscopes for studying the cells. Microscope is an indispensable…
Q: question 11 Explain the role of streptomycin in the lab. 1. Streptomycin was the bacteria to which…
A: Antibiotics are the medications that are used to treat bacterial diseases
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- structures which are hygroscopic and uncurl from the spore upon drying, aiding in spore dispersalenationsindusiumelaterssoriWhich of the following statement(s) or feature(s) apply to Amoeba proteus? Sclect 3 comect answaits Eukaryote Possess a nucleus Unicellular organism Can do photosynthesis Multicellular organism Prokaryote BacteriaNumber of Bacteria X Temperature (°C) At the After 1 After 2 After 3 beginning day days days 6. 8. 12 15 48 187 15 27 126 678 (a) What is the relationship between the temperature and the rate at which the Bacteria X reproduces? (b) When the number of Bacteria X increases, it causes food to turn bad and cannot be eaten. Based on the results above, what can Rose do to preserve food for a longer period of time? Explain your answer.
- BOOkmarks People Tab Window Help O Pro/Eu, Kingdom x - apsva.instructure.com/courses/57285/assignments/764473?module_item_id%3D1581469 jefferson lab A Artington Public S.. M KEnrique Oliva Tec.. O Unit 1 Equations,.. 4 1 point What is the function of a paramecia being torpedo-shaped and covered in cilia? stretch and contract to move travel easily through blood vessels send messages to and from the brain swims easily to find a food source 4 points Read each statement, then select whether it applies to Prokaryotes, Eukaryotes, or Appeared first, approximately 3.5 billion years ago Has a nucleus Has ribosomes Simple. Does not contain any membrane-bound organelles. linadem is onYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT# Fnternet has become a hoon today for the students especially in this acdverse condition of global pandlemic Write an essay exgolain- and cons of using the intemet. saud ing the
- 9:18 A docs.google.com * Pitted is Spire Ornamentatio Coiled O Shell O * Scaphopoda have Carry bag O Sac O Cyst Siphon O * Fauna is Phytic O Zoic Plants Trees O1000x Multicellular, photosynthetic Volvox Aggregate Protococcus cells Simple colony Scenedesmus cells Epithelial cells from a multicellular animalean.khpcontent.com/biology/page/ch23pretest?type question-list&page_type-6896389 D YouTube * Maps raprer 1 Ablgall CAMERON- October 03, 2021 12:45:43 PM Return to Site 4. 56 1 3 9 10 11 12 13 14 15 16 17 (15 of 17) Match each group in the left column with the corresponding grouping in the right column. Marchantiophyta А. Non-vascular plants Lycopodiophyta В. Seedless vascular plants С. Pterdiophyta Non-vascular plants D. Seedless vascular plants Bryophyta E. Non-vascular plants Anthocerophyta Note: Clicking any button other than the Save Answer button will NOT save any changes to your answers! Save Answer Skip Question I Am Finished/Submit for Grade
- CR Sains Tingkatan & Bab (b) Gariskan jawapan yang betul Underline the correct answer (0) (Protozoa / Alga) terdapat dalam usus anai-anai untuk menghasilkan enzim selula 3 Rajah berik mencernakan selulosa kepada glukosa (Protozoa/Algae) are found in the intestines of termites to produce cellulase enzyme to digest o into glucose quad (1) (Pungi/Bakteria) menyingkirkan lemak dan tisu daripada kulit haiwan untuk pes barangan kulit. (Fungi Bacteria) remove fats and tissues from the skin of animals for manufacture of leather go 2 (a) Tulis kegunaan mikroorganisma dalam melestarikan alam sekitar dengan menggunakan makl yang diberi di bawah. Write down the uses of microorganisms in sustaining the environment using the information given belo Bakteria pengurai digunakan untuk menguraikan organisma mati Decomposing bacteria are used to decompose dead organisms • Bakteria pengikat nitrogen menukarkan nitrogen kepada nitrat Nitrogen-fixing bacteria convert nitrogen into nitrates • Menguraikan sisa…020-2 b My Qu X All Cha Nazare Permis h BIO210 Co X Master Anator Chapte um.ecollege.com/course.html?courseld%3D156741508OpenVellumHMAC=54e94737743258a7158dac000d4797e4#10001 Chapte Q Upgra Q Ch. 4 Ft Fall 2020 (page 2 of X elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D697149&page3D1 System (Academic) The reason why Bacteria stain differently is mainly based on their: Select one: O a. Number and thickness of smear O b. Cell wall structure O c. Presence/absence of nucleus O d. Size O e. Origin In the image provided, the basic unit of life is represented in the.....SEE MORE QUESTIONS
