GFP is fluorophore that:   is used to observe fusion proteins in living cells   is synthetic    comes from fireflies   emits at460 nm

Q: Please answer fast Imagine that you have a water sample containing two different species of…

A: Microbial isolation techniques can be used to grow pure cultures of microorganisms, which can then…

Q: Which of the following is most responsible for horizontal gene transfer? Non-orthologous gene…

A: Horizontal gene transfer (HGT) is the exchange of genetic material between organisms and is a…

Q: Polymerase extracted from Thermococcus litoralis has a much higher fidelity than Taq polymerase.…

A: Introduction :- The capacity of a DNA polymerase to accurately replicate a template is referred to…

Q: Binary fission in bacteria is beneficial for all of the following reasons EXCEPT: Group of answer…

A: Binary fission is the process in prokaryotic organisms, where a single cell divides into two cells…

Q: Why do we extracted a cell from a donor

A: Somatic cell nuclear transfer (SCNT), a technique in which the nucleus of a somatic (body) cell is…

Q: A piece of DNA ejected by a bacterial cell through a tube-like passage through the cell wall is…

A: Bacterial cells divide by binary fission in which one parent cell divides into two identical…

Q: If a bacterial cell is F+, that cell must

A: The microbiology studies about both the diseases causing microbes and beneficiary microbes, about…

Q: Which of the following plates should contain only transformed bacteria? Check All That Apply +PGLO…

A: In the field of genetic engineering, bacterial transformation is a key technique used to introduce…

Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…

A: Several types of techniques are incorporated in the molecular biology to get more desirable results…

Q: Bacterial transformation involves DNA transfer to a recipient cell

A: Answer: Recipient bacterial cell : These are the bacterial cells which receives the DNA in to the…

Q: Two different T4 rll mutants are used to co-infect E. coli strain K(A)". Lysis was extremely rare…

A: *T4 rII system is used to to investigate gene substructure. It is based on genetic crosses between…

Q: Refer to the following illustration to answer the questic The illustration shows: O a lysogenic…

A: The transposable genetic element also named as mobile genetic element or jumping genes. They can be…

Q: Which of the following is the specific gene that is most often used for DNA Barcoding of animals?…

A: Animal DNA barcoding is a biological method that allows species identification and differentiation…

Q: For you master's degree you have joined a lab that seeks to identify and investigate novel organisms…

A: In research cell culture is an important technique for growing cells in a controlled environment,…

Q: Below is an image of an organism under 100 X magnification. Is this organism prokaryotie eukaryotic?

A: The diagram given in the question, age of an organism belonging to the family of Protista. Belongs…

Q: Can the Eukaryotic Cell (Plant) figure in the circle with all the figure's markings be drawn by…

A: Eukaryotic cells in plants are cells with distinct nucleus and nucleolus. The cell contains…

Q: Let's imagine: an alien with prokaryotic cells wants to destroy an infection caused by human cells.…

A: While designing drugs the main concern is to target the pathogenic cells specifically.

Q: If a mixture of bacteriophages (viruses), some labeled with radioactive sulfur in their protein coat…

A: Bacteriophages are defined as viruses that will infect the bacteria and replicate only inside the…

Q: In John Gurdon's nuclear-transfer experiments, he used nuclei from tadpole intestinal cells. Do you…

A: Growth alludes to the expansion in mass and size of a body. Development is the cycle where a…

Q: What do the results of Hershey and Chase's experiment show? * O DNA is composed of a double helix. O…

A: Alfred Hershey and Martha Chase were two important scientists who carried out the experiment using…

Q: A patient has a Haemophilus influenzae respiratory infection. She is prescribed Amoxicillin.…

A: The various modes of horizontal gene transfer in bacteria are transduction, transformation, and…

Q: Name of Organism: Citrobacter freundii Туре of Medium Color Before Incubation Color After (Same for…

A: Citrobacter freundii is a gram-negative bacteria that is rod-shaped and belongs to the bacterial…

Q: Horizontal gene transfer between bacteria occursthrough three mechanisms: transformation,…

A: The process of transmission genes from one organism to another is termed as gene transfer. There are…

Q: You were interested to see a human cell under the microscope, so you went to the lab to look for a…

A: Staining is the technique which is used to visualise cells and small specimen under microscope .

Q: In a eukaryotic cell, where can you observe genes in action? Chloroplasts  Nucleus  Mitchondria…

A: A cell is the basic unit of life.  All living creatures are made up of cells, ranging from…

Q: Nucleus Rough ER Golgi apparatus Plasma Vesicle membrane

A: Vesicles are involved in the transport of materials to and forth from the plasma membrane into the…

Q: Correctly label the following parts of a mature sperm. Tail Midpiece Mitochondrion Head Nucleus…

A: Reproductive system:The sex of the fetus is decided at the time of fertilization. However, by the…

Q: In John Gurdon's nuclear-transfer experiments, he used nuclei from tadpole intestinal cells. Do you…

A: There are two distinct types of cloning: reproductive and therapeutic. Both processes can be…

Q: The transfer of DNA from one bacterium to another through a sex pilus is termed ___________?…

A: Bacteria do not have an essential sexual reproductive stage in their life cycle, yet they can be…

Q: Bdellovibrio would be great to use to treat all human pathogens, but it cannot be used as biological…

A: Based on an experiment conducted in 1992 by Jackson and Whiting, Bdellovibrios is a potential agent…

Q: All of the following contribute to prokaryotic genetic recombination of DNA EXCEPT conjugation…

A: Bacteria is a prokaryotic organism. It contains nucleoid and lacks membrane bound organelles.

Q: describe: The way in which the magnetosomes present in the bacteria behave like magnets.

A: Microbes, also referred to as microorganisms, as they are stated they are usually invisible to the…

Q: If you want to track the movement of a protein in a live cell, the best technique to use would be…

A: Proteins are the macromolecules which play many important roles in living organisms. Amino acids are…

Q: Endogenote Exogenote Mating bridge Sex pilus M A tube connecting an F+ to an F- bacterium during HGT…

A: The study of bacterial genetics includes the genetic material acquisition and transfer processes. In…

Q: conjugation enetic variation biotic resistance ONA replication binary fission tic recombination…

A: In the image a concept map is shown. This concept map shows the process of development of antibiotic…

Q: You are working with an intestinal bacterium of humans, which you have in pure culture (in liquid…

A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…

Q: You have several different media onto which you inoculated eight strains of yeast (A-H). The media…

A: Minimal medium (unsupplemented) A minimal medium is a growth medium used for growing microbes and…

Q: A researcher is comparing the sequences of genes encoding cell wall proteins in archaeons with those…

A: Comparative genomic studies play a vital role in understanding the genetic differences and…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: Categorize the following as being associated with transformation, conjugation, or transduction. Note…

A: There are three principal methods of genetic transfer between bacteria. Transformation deals with…

Q: In the Griffith experiment, why didn't the bacteria from rough colonies harm the mice? Because they…

A: Bacteria like Streptococcus do not have membrane-bounded organelles, can reproduce individually,…

Q: Why is yeast RNA insoluble in cold water, ethanol, and dil. HCl solution

A: yeast belongs to the fungi.

Q: Where does Taq polymerase come from?

A: Taq polymerase is the vitalmost polymerase enzyme in modern biochemistry. It has versatile range of…

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.