From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression specific transcription factors O S' UTR O mediator protein O coding sequence activators O 3' UTR RNA polymerase II general transcription factors

From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression specific transcription factors O S' UTR O mediator protein O coding sequence activators O 3' UTR RNA polymerase II general transcription factors

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Related questions

Q: Explain the major difference between diffusion and osmosis.

A: Osmosis- osmosis is a process by which solvent molecules moves from a region of less to high concent...

Q: The LB/Amp plate containing E. coli (+)pGLO would be fluorescent

A: The pGLO plasmid you used contains an araC gene, a GFP gene and a bla gene. If you performed the exa...

Q: What's the correct answer and why? I'm confused on how lacZ expression works.

A: Lac operon is a group of genes with single promoter. The genes in the operon encode proteins that al...

Q: HOW each variable influence the distribution of different biomes and distribution of flora and fauna...

A: Ecosystem diversity refers to the different types of ecosystems occurring in an area. For example De...

Q: How does caffeine effect plant growth?

A: In this question we will discuss about how caffeine effects plant growth.

Q: Effects of BPA on phosphorylation of JAK family in RAW264.7 cells

Q: Question # 17 What are living and nonliving reservoirs?

A: Introduction In this question we will discuss about the living and non-living reservoirs.

Q: State the three (3) important maturity stages at which ginger can be harvested and identify the prod...

A: Ginger (botanical name - zingiber officinale) is a herbaceous perennial rhizome species that is used...

Q: First is the occurrence of (1) found in geologic strata. Write the answer for #1

A: Introduction Strata are layers of rock, it forms during sediment deposition, that is, the laying dow...

Q: How can growth in aquaculture result in a proportional increase in disease problems? Explain compreh...

Q: dye-linked substrate called X-gal (5-bromo-4-chloro-3-indolyl-ß-D-galacto-pyranoside) into galactose...

A: The lac operon contains a group of related genes (promoter, operator, Lac Z, Lac A, and lac Y) that ...

Q: A horse which has an allele for red fur and an allele for white fur has some white hairs on its body...

A: Allele is one of two or more possible forms of a gene that are found at the same place on a chromoso...

Q: Define the purpose of producing many copies of the gene’sencoded protein in a host cell ?

A: In a single gene, information for making specific protein is encoded. Genes are long, consists of th...

Q: 11. In a dihybrid cross, we consider two traits at the same time. Suppose in a species of fish, long...

A: Introduction: Heterozygous refers to the inheritance of an organism of different forms of a specific...

Q: In what way has the production of human insulin by recombinant DNA methods had significant medical a...

A: human insulin is prepared by using two important methods: 1. Semisynthetic human insulin synthesized...

Q: Explain the importance of cDNA libraries ?

A: All of the DNA sequences that are transcribed into mRNA are contained in a cDNA library. To ensure t...

Q: 1.How to find out or judge the the biocompatibility of a biomaterial? What experiments you need run ...

A: Biocompatible material are the inorganic material that do not elicit a foreign body response through...

Q: A peptide with 19 amino acid residues was digested with trypsin and generated the following fragment...

A: The one letter code for different amino acids are :- G - glycine I - isoleucine R - arginine S - ...

Q: There are three types of photosynthetic pigments. Name and describe each pigment.

A: Photosynthesis is the process that allows plants to convert sunlight into chemical energy they can u...

Q: can you help me how to make frameshift mutation and pls explain

A: INTRODUCTION Frameshift mutation is a process of insertion or deletion of nucl...

Q: Read and highlight ways limiting factors affect the population growth. Examples of how limiting fact...

A: Introduction Limiting factor:- It is anything that constrains a population's size and slows or stops...

Q: Define the following terms in your own words: Homologous character Character state Clade Cladogr...

A: Cladograms can also be known as phylogenies or the tress.

Q: Define the genomics era of modern genetics ?

A: Genomics is study of Genes of all human beings including the interaction between all Genes according...

Q: 1. What is carrying capacity? 2. How do limiting factors affect carrying capacity?

A: Introduction: The carrying capacity of a population is the maximum number of people that a location ...

Q: . Determine the genotypes, phenotypes, genotypic ratio, and the phenotypic ratio of the following tr...

A: A trihybrid cross is a cross in which three traits ae involved . As per the question , three traits...

Q: A species of barnacle may be able to exploit a large volume of habitat but due to competition from o...

A: Introduction: A species is the largest group of organisms in which any two individuals of the approp...

Q: The normal microbiota of the respiratory system contains opportunistic pathogens. True O False

A: Many microorganisms of respiratory microbiota are opportunistic pathogens. They help in protecting f...

Q: Estimate the number of hominin species that have existed in both robust and gracile clades of evolut...

A: Researchers have narrowed down on the fact that based on the number of unearthed fossils, there were...

Q: Effects of BPA on phosphorylation of MAPK family in RAW264.7 cells conclusion

A: Bisphenol A or BPA is one of the key component of polycarbonate plastics and it causes a wide range ...

Q: Please answer, not much defination needed . (1) Parathion causes a very simple inactivation of an en...

A: Parathion It refers to an organophosphate pesticide that has a color of pale yellow to dark brown. I...

Q: How can we differentiate so many different foods if we can only taste four flavors on our tongue: sw...

A: Introduction In this question we will discuss how we can differentiate so many different foods if we...

Q: In 1953, Watson and Crick discovered the structure of DNADNA by examining data from many different e...

A: Humans and practically all other species have deoxyribonucleic acid or DNA as their hereditary mater...

Q: DIFFERENTIATE the two factors of species diversity. (Species richness and relative abundance)

A: Answer Differenciate the two factors of species diversity (species richness and relative abundance)...

Q: Distinguish between modes of mesoderm formation

Q: Exploring Further: The table below outlines the stpes in eukaryotic gene expressions. Briefly summar...

A: Gene expression steps molecules involved summary Transcription mRNA, small and large ribosomal...

Q: Describe the experimental evidence which supports the rotational motion of the y- and e-subunits of ...

A: Describe the experimental evidence which supports the rotational motion of the gamma and e-subunits ...

Q: How many antigen-binding sites does an antibody usually have? 4 1 2

A: Immune system is system which helps our body to fight against the foreign substances which will caus...

Q: PROBLEM 1: A man with a hitchhikers thumb (Hh) and his wife who also has a hitchhikers thumn (Hh) ar...

A: A dominant allele is the Allele which will supress the effect of alternate allele . On the other han...

Q: What are the differences between direct and indirect life cycles? Give two (2) representative parasi...

A: Parasites are the organisms which lives and reproduce inside other organisms known as host.

Q: The process of starts with a molecule of and has an output of pyruvate.

A: Photosynthesis is the process through which plants convert sunlight, water, and carbon dioxide into ...

Q: How does gene mining contribute to the development of antibiotics?

A: The process of Genome or gene mining describes the use of the genomic information for the discovery ...

Q: Both archaea and eukaryotes have______ . a. peptidoglycan c. a nucleus b. histone proteins d. a caps...

A: Introduction :- Eukaryotes are organisms with a nucleus and other membrane-bound organelles in their...

Q: What are the benefits of tryptophan?

A: Introduction Tryptophan:- Tryptophan is an α-amino acid that is used in the biosynthesis of proteins...

Q: aving freckles is determined by a dominant allele (F); no freckles is determined by a. cessive allel...

A: Gregor Johan Mendel , was an Austrian Monk out Brunn Monastery who studied it Vienna University. He...

Q: Describe the process that occurs in glycolysis. Be sure to describe all phases and products througho...

A: Glycolysis is the first step in the breakdown of glucose to extract energy for cellular metabolism. ...

Q: A commonly used plasmid that we will use in this lab is PUC19: (New England Biolabs) Indl 91 BamBI 5...

A: pUC19 is a circular double stranded DNA having 2686 base pairs.It is one of the most widely used rec...

Q: What are the different types of Plant Growth?

A: Introduction In this question we will discuss about the different types of plant growth.

Q: Earth is about 4.5 billion years old. In order to characterize the events that happened in this very...

A: Geological time scale can be defined as sequence of geological events happened in the history of ear...

Q: Give one similarity and two differences between oxidative phosphorylation and the light reaction of ...

A: 1) In Oxidative Phosphorylation ATP is produced using different enzymes and oxygen. E.g. succinate...

Q: 2. How would you expect the staining properties of 24-hour culture of Bacillus subtilis or the other...

A: Note: Ad per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: The...

Question

i need help getting the right answer for the queshtion

From the list given - choose all of the regulatory proteins that would
bind the eukaryotic gene to control its expression
specific transcription factors
O S' UTR
O mediator protein
O coding sequence
O activators
O 3' UTR
RNA polymerase Il
general transcription factors

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

RNA polymerase O Transcription to produce pre-mRNA O Post- transcriptional modification Nuclear pore complex OExport of mature mRNA into cytoplasm OPost- Ribosome with transfer RNAS translational O Translation of OProtein folding modifications. mature mRNA Look at the image above: 3. Where does transcription specifically take place in the cell? 4. Where does translation specifically take place in the cell?
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
TAN TTGC IGGAG Nanog regulatory sequence Given this interaction map which DNA sequence would the transcription factor most likely bind to? CAAGGAG ATTAACG TAATTGG TAATTGC
You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein). You have just woken up to a transcription factor sitting down on your local TATA box. Tell me all your life events from beginning vou just saw the transcription factors) to end fyour protein death). Don't forget to mention WHERE you have lived during your life, how you have moved, what helped you along the way, and all the other proteins and other small molecules you have
A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook like
From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression THERE ARE MULTIPLE ANSWER TO THE QUESTION Group of answer choices A RNA polymerase II B 3' UTR C mediator protein D 5' UTR E activators F coding sequence G specific transcription factors H general transcription factors
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
| What is translational repression? Explain why do cells use translational regulation to respond to signal cues like heat shock in the environment ? NUCLEUS CYTOSOL RNA transport translation control protein activity control control RNA transcript mRNA 1 3 MRNA. inactive protein DNA. -protein. transcriptional control RNA nuclear pore processing control nuclear envelope
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
How would transcription be affected in eukaryotic cells if Mediator was deleted? Group of answer choices Transcription would occur, but a basal level Transcription would be unaffected with normal levels of transcript produced Transcription would be accelerated Transcription would be aborted and no transcription would take place
Compared to heterochromatin, euchromatin is comprised of densely packed nucleosomes and with higher transcription activity comprised of densely packed nucleosomes and with lower transcription activity O comprised of loosely packed nucleosomes and with lower transcription activity Ocomprised of loosely packed nucleosomes and with higher transcription activity
Select the processes that only happen inside the nucleus of a eukaryotic cell. Select all that apply. O making tRNA O transcribing rRNA O removing introns from precursor mRNA O transcriptional initiation at the promoter O adding the polyA tail O mRNA binding to the small ribosomal subunit ORNA splicing O tRNA binding to codons