features mitochondria retain but peroxisomes apparently lost over hundreds of millions of years: Select all that apply.   RNA synthesis oxidation of fatty acids DNA replication protein synthesis replication by division inner and outer membranes ATP synthesis

Q: In the late 1960s (and since), Lynn Margulis (and others) provided considerable evidence for the…

A: Endosymbiotic theory states that the eukaryotic cells are a result of endosymbiosis between a larger…

Q: The concept of endosymbiosis as applied to chloroplast and mitochondria found in eukaryotes: a) is…

A: Endosymbiosis is a kind of relationship in which one organism enters in an another organism. The…

Q: In the evolution of the eukaryotic cell, these cells have evolved key changes that include which of…

A: A eukaryote is a cell or creature with a nucleus that is clearly defined. Eukaryotic cells are found…

Q: Which of the following observations constitutes evidence that mitochondria evolved before…

A: Mitochondria is an important double-membraned cell organelle present in all eukaryotic cells. It is…

Q: Describe IN YOUR OWN words what the “endosymbiotic theory” is. What evidence supports this…

A: Endosymbiotic theory was repopularized in 1967 by Lynn Sagan (later Margulis) and also mentioned in…

Q: The origin of the photosynthetic eukaryote took place when a ______ was engulfed by a later…

A: Answer : The origin of the photosynthetic eukaryote took place when a ______ was engulfed by a later…

Q: The evolution of the highly complex eukaryotic cell was possible because.. A) Mesosomes released…

A: Correct answer is (B). Two different prokaryotic bacterial species entered the complex cells as endo…

Q: What evidence do scientists observe today that supports the theory of endosymbiosis? Select all that…

A: Endosymbiosis Symbiosis is a mutually beneficial relationship where both organisms are benefitted…

Q: Eukaryotic cells might have evolved from early prokaryotic cells living in close association. What…

A: The endosymbiotic theory supports that the organelles that are present in the modern eukaryotic…

Q: Now imagine that you are pretty wimpy ancestral eukaryotic cell, incapable of either cellular…

A: Introduction  Evolution is the process of change over time in the characteristics of populations of…

Q: Describe in sentences how having organelles is important for creatures to be multicellular.  (ex.…

A: An organism can grow larger than the size restrictions often enforced by diffusion when it is…

Q: Imagine you are the chief biologist at NASA when Perseverance Ill returns from its mission to…

A: Pulse- chase experiment analysis is a technique used to examine cellular  processes that occurs over…

Q: Complex cells that contain a nucleus and other organelles are called_______ cells. A compelling…

A: Complex cells that contain a nucleus and other organelles are called__Eukaryotic_____ cells. A…

Q: Identify two features of organelles that support theendosymbiotic theory of organelle evolution.

A: Introduction  Life starts on earth around 3.4 billion years ago, in the ocean. Primitive organism…

Q: Explain why evolutionary biologists are interested in choanoflagellates, green algae, and organisms…

A: Evolutionary biologists are very interested in choanoflagellates, green algae and organisms with…

Q: Name three facts that show that mitochondria have bacterial origins.

A: Mitochondria is a power house of the cell that produces the energy in the form of ATP.

Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…

A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…

Q: vidence that glycolysis evolved before the eukaryotic cell evolved?

A: Eukaryotic cells are cells that have a definite nucleus and specialized organelles. Glycolysis is…

Q: Which organelle is involved in conversion of pyruvate to acetyl coa? Stores dna and is the site…

A: A eukaryotic cell is characterized by various cellular components and biomolecules. Each cell…

Q: The host eukaryotic cell may try to travel to places in the ocean where there is a lot of decay.

A: Cyanobacteria are also referred to as the Cyanophyta. It is a phylum of prokaryotic organisms…

Q: Mitochondria and chloroplast have their own DNA and replicate separately from the nucleus and they…

A: Genetic is the branch of science that deals with genetic material like genome, genes, DNA, and…

Q: . Name the two organelles and their modern function . Give at least 2 pieces of supportive evidence…

A: An endosymbiont is one organism that lives within another. Every single eukaryotic cell, are…

Q: how endosymbiosis, and the evolution of mitochondria, was a critical factor in affecting cell size…

A: Cellular size and growth is determined by the metabolic activity and the involvement of…

Q: DNA in animal cell is found in  A- Nucleus B- nucleus and mitochondria  C- mitochondria D-…

A: Given:    DNA in animal cell is found in.

Q: Name and describe the idea that explains how mitochondria and chloroplasts are thought to have…

A: Photosynthesis is the process through which green plants and some organisms use sunshine to convert…

Q: Endosymbiotic theory can be applied to Biomolecules as it invloves the development of nucleic acid…

A: Endosymbiotic theory: This theory explains how Organelles arose in organisms. Mitochondria,…

Q: If endosymbiosis generated mitochondria and chloroplasts from an ancestral proteobacteria and…

A: Mitochondria are double membrane-bound cell organelle and they also contain double-stranded circular…

Q: One organism found in a termite’s gut is Mixotrichia paradoxa. This strange creature looks like a…

A: We could describe it as a colony functioning together. Where spiral bacteria on the surface may be…

Q: Define the endosymbiotic theory. Explain how mitochondria and chloroplasts evolved by endosymbiosis.…

A: Life in the world started as a single celled organism. By means of accumulation of mutations,…

Q: ts explain the existence of mitochondria and chloroplasts with the endosymbiotic hypothesis. What is…

A: Endosymbiotic hypothesis tries to explain the origin of mitochondria and chloroplast .

Q: "flagellum is an ancient eukaryotic organelle".

A: Eukaryotes have enclosed nucleus within the nuclear envelope. Eukaryotic cells have membrane bound…

Q: Describe the characteristics of the mitochondria and chloroplast that separates them from organelles…

A: It became evident that the cytoplasm of eukaryotic cell is traversed by a complex network of…

Q: Evolution of complex cells Discuss the significant changes that are represented in the evolution of…

A: Prokaryotes are the organisms without a true nuclear member whereas eukaryotes are the organisms…

Q: Mitochondria and chloroplast have their own DNA and replicate separately from the nucleus and they…

A: The branch of science that deals with genetic material such as the genome, genes, DNA, and proteins…

Q: The extra energy required for the evolution of the highly complex eukaryotic cell was possible…

A: A cell is composed of several cell organelles. Besides the nucleus, mitochondria and chloroplasts…

Q: The ancestor of the chloroplasts found in modern day land plants was/is; A photosynthetic prokaryote…

A: A Chloroplast is a cell organelle which is found only in algal and plant cells. Chloroplast is…

Q: Illustrate and explain the evidence supporting the predominant Theory on the origin of energetic…

A: Question: Illustrate and explain the evidence supporting the predominant Theory on the origin of…

Q: A scientist discovered a new group of unicellular organisms that lack mitochondria but possess an…

A: Mitochondria are membrane-bound organelles found in eukaryotic cells, and is involved in energy…

Q: . Why was the great oxygenation event important for mitochondrial development? a) In your own…

A: According to Bartelby's authoring guidelines, we can only answer the first question along with its…