Ex 9) Devise a flowchart to receive a positive number and output how many of its digits are equal to 5. For instance, if the input is 5155, the program should output 3, because there are three fives there. Another example, if the input is 14368, the program should output 0. Ex 10) Devise a flowchart to receive a positive number and output the product of its final five digits (or its final digits, if they all number less than five). For instance, if the input is 12811, the program should output 16, because 1*1*8*2*1 is 16. Another example, if the input is 23 the program should output 6. However, if the input is 712811 the program should output 16, as the first digit will be ignored.

Im creating a Web page that calculates a tip, total bill, and splits the bill based on user info. Javascript. See instructions.

this in r language

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…