Differentiate the reproductive structures and processes of the four plant representatives according to the categories provided. Bryophye Pteridophyte Gymnosperm Angiosperm TWO distinguishing characteristics of fertilization

Differentiate the reproductive structures and processes of the four plant representatives according to the categories provided. Bryophye Pteridophyte Gymnosperm Angiosperm TWO distinguishing characteristics of fertilization

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter27: Reproduction And Development Of Flowering Plants

Section: Chapter Questions

Problem 4SA: In flowers, the structures that produce male gametophytes are called _______ ;the strcutures that...

See similar textbooks

Related questions

Q: To explain: How the pyruvate can be used to produce АТР.

A: Cellular respiration is a biological process that releases chemical energy from food and converts it…

Q: A plant that grows very close to the ground, tends to be small in size, favors moist environments…

A: Given: Plants are the primary source of nutrients for all living organisms. Plants take sunlight for…

Q: A nuclear power plant employee, 20 years old, was entered the hospital with a diagnosis of "acute…

A: Acute radiation sickness is condition which occurs in a person who has been exposed to a high amount…

Q: major life zones characterized by vegetation and climate, primanly average temperature and…

A: Tropical regions contain tropical forest. These are characterized by hot temperatures all the year…

Q: To find: The artery that carries oxygen-poor blood.

A: Inside the body, blood flows through specific blood vessels. The blood has been classified into…

Q: How can you avoid having infections?

Q: Unknown 14 | Genus Species (Bergey) Identified Organism Characteristic: Gram reaction, Shape…

A: NOTE: Please note, that we are not allowed to cite external references as it violates our company's…

Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…

A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…

Q: Learning Task 13-1: Diseases Caused by Mutations Disease What gene is affected by Mutation? What is…

A: A genetic disorder is a medical condition caused by one or more genetic defects. A chromosomal…

Q: Gel-filtration chromatography separates molecules according to their size . Smaller molecules…

A: Gel-filtration chromatography is a type of separation technique that uses a gel as a medium through…

Q: In a couple paragraphs, describe the connection and correlation between the red-shouldered hawk, the…

A: Introduction A statistical approach for determining the relationship between quantitative and…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: The tip of a plant like the prairie species we grew in class, where cells are continuously dividing…

A: Plants undergo primary growth to increase length and secondary growth to increase thickness.Growth…

Q: acidosis

A: Acidosis: Acidosis is the condition where there is too much acid in the body fluids. Acidosis is…

Q: What kinds of labels do school authorities apply to students? What is the outcome of those labels?

A: Labelling in schools is a very common process nowadays. This has led to the development of some…

Q: Operon X produces three enzymes that convert Compound A to Compound B. The R gene makes the…

A: Gene expression is given on the basis of RNA. It is a process through which there is turning on of…

Q: In a particular dihybrid (T/t, B/b) the alleles of the "T and "B"genes indicated in the figure below…

A: Meiosis is a process where a single cell divides twice to produce four cells containing half the…

Q: Cloning is the replication of all or part of an organism. Although cloning is still a developing…

A: Cloning is a technique scientists use to make exact genetic copies of living things. Genes, cells,…

Q: When there is light, plants release oxygen. What else may plants also use oxygen in? photosynthesis…

A: Plants release oxygen from photosynthesis. Photosynthesis is a process in which green plants prepare…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: 3. Please select all true answers. Myosin I is simple and often associated with the plasma membrane,…

A: Myosins are the motor proteins based on actin filament.

Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…

A: Mutation is a permanent change in some nucleotide sequences in an organism's DNA that can cause…

Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…

A: A trait is a characteristic features that is exhibited by particular individual . As per the…

Q: Which of the following statements about cellular respiration is TRUE in eukaryotes? A. For every…

A: Cellular respiration is a metabolic processes consisting of series of steps to convert chemical…

Q: If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is…

A: We got the information of first type in carboxyl terminus of soluble ER proteins and in golgi…

Q: 2 2. A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…

A: R r R RR Rr r Rr rr The phenotypic frequency R can roll their tounge to r who can't roll…

Q: . What is meant by a bacterial “colony” or colony-forming unit? 2. Why are colonies that develop on…

A: Since you've asked multiple questions, we're only answering the first three answers for you. If you…

Q: 17 Match the number of the label in the diagram below with the appropriate site or structure from…

A: Electron transport chain Also called the ETC is composed of four protein complexes. These protein…

Q: Below is a Figure of a Shoot Tip, indicate which numbers is/are meristematic cells? 4 13 5. 21

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: 21 Explain the process of photorespiration.

A: Photorespiration is the light dependent process of oxygenation of ribulose bisphosphate (RuBP) and…

Q: Explain the steps involved in translocation of sucrose.

A: Xylem and phloem are the vascular tissues present in the vascular plants.

Q: DNA is composed of .which are attached to each other by bonds. O A) nucleotides. phosphodiester O B)…

A: DNA or Deoxyribonucleic acid is the genetic material in humans. It was discovered as a double helix…

Q: here is a benign congenital condition called Hereditary Persistence of Fetal Hemoglobin (HPFH) in…

A: Hereditary Persistence of Fetal Hemoglobin is the condition when there is still fetal hemoglobin…

Q: Explain two ways that soil can lose nutrients.

A: * The soil can lose its nutrients by soil erosion, runoff, leaching and burning of crop residues. *…

Q: To explain: How a compound can be perceived as both sweet and bitter.

A: Taste receptor cells mediate taste sensations and preferences. Taste receptors are chemoreceptors…

Q: The following pedigree shows a particular trait which is absent in the parents but found in the…

A: Introduction - A pedigree chart is a graphic that depicts the prevalence and appearance of…

Q: Explain why are B cells known as Antigen Presenting cells and what happens after antigen…

A: As B cell has MHC class II so that it can present antigen. B celk has IgM or IgD antibody that…

Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.

A: When a change occurs in an animal’s environment, an adjustment must be made. The receptor senses the…

Q: Question 2 1 pts The nundber and size of organelles in a cell correlates with that cell's function.…

A: Microtubule along with intermediate fillament and microfillament form cell cytoskeleton.…

Q: Which of the following statements regarding RNA is false? O A) RNA is a nucleic acid. O B) One RNA…

A: RNA stands for Ribonucleic acid. It is one of the genetic material present in the cell. The whole…

Q: Match each vitamin with the correct deficiency or toxicity condition or symptoms Vitamin C [Choose]…

Q: Assume that we want to minimize a function using evolutionary algorithm. For our coding process, we…

A: Let us assume number of slots in roulette is 38 Where C1 occur 5 times Therefore getting C1 =…

Q: Why did Carl Woese propose the domain Archaea? The domain Bacteria already had too many organisms in…

A: Carl Woese propose the three domain classification. He propose that all cellular life is divided…

Q: What do coral cores show us??

A: Introduction Corals are marine invertebrates that belong to the phylum Cnidaria's class Anthozoa.…

Q: Why did Mendel self-pollinate the tall F1 plants to get the F2 generation and crossed a pure…

A: Introduction - The law of dominance, the law of segregation, and the law of independent assortment…

Q: Gestalt theorists were interested in how we determine which part of the environment was more…

A: Gestalt theories Gestalt, experimental psychologists believed and suggested that the perception of…

Q: The renal pyramids appear striped because they are made up of parallel bundles of the collecting…

A: The kidney is divided into a cortex and an inner medulla. The medulla is further divided into…

Q: During aerobic respiration, high energy electrons are taken from glucose and transferred to electron…

A: Cellular respiration takes place either aerobically or anaerobically inside the cells. In case of…

Q: Select the option that is a scientific hypothesis and is testable and false able?(Choose all that…

A: As per our company guideline we are supposed to answer only first question. Kindly repost other…

Concept explainers

Embryology

Question

Differentiate the reproductive structures and processes of the four plant representatives according to the categories provided.

	Bryophye	Pteridophyte	Gymnosperm	Angiosperm
TWO *distinguishing* characteristics of fertilization
TWO *distinguishing* characteristics of embryogenesis

Definition Definition Flowering plants that produce fruit and seeds.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Differentiate the reproductive structures and processes of the four plant representatives according to the categories provided. Bryophye Pteridophyte Gymnosperm Angiosperm Female reproductive structure and distinguishing characteristic Male Reproductive structure and distinguishing characteristic
Lilium Ovary Describe the function of each structure (Central column, ovule, funiculus, septum, pericarp, and locule) Compare the lily ovary to the pistillate strobilus of a gymnosperm
Part B: The Embryo Sac Examine the demonstration slide of a c.s. of a lily ovary. Find an ovule. Identify the funiculus, the chalaza, the integuments, the micropyle, and the developing female gametophyte. The latter is commonly referred to as the embryo sac in angiosperms. If your slide has several embryo sacs, they are likely to be at variable stages of development. (See text Figure 19-18b,c, page 469.) Like the female gametophyte in pine, the embryo sac develops from a megaspore. 5. Label the ovary wall, ovule, integuments, and developing embryo sac in Figures 3. and 4. below. Figure 3. Lilium ovary c.s. Photo by Carolyn Alling 126 uilid Sengit olybiolq sdh ei todW A Figure 4. Lilium ovule c.s. (Enlargement of inset of Figure 3)
Several structures work together to allow flowering plants to reproduce The diagram shows a typical flower. Anther Filament Stigma Style Ovary Sepal hich table correctly identifies the function of each structure or group of structures in the reproduction of the Protection for embryo Foa productton and ombnio dovolomont Previous
Diagram the structure of a mature angiosperm and amature gymnosperm seed, indicating the ploidy (1n, 2n, 3n) ofeach tissue and its role in seed development and germination.
Figure 25.24 Which of the following statements about the fern life cycle is false? Sporangia produce haploid spores. The sporophyte grows from a gametophyte The sporophyte is diploid and the gametophyte is haploid. Sporangia form on the underside of the gametophyte.
In an angiosperm life cycle, sexual reproduction includes: meiosis within the male gametophyte to produce sperm. meiosis within the female gametophyte to produce eggs. meiosis within the ovary to produce megaspores. fertilization leading to development of microspores. fertilization leading to development of megaspores.
Figure 23.28 Which of the following statements about the Laminaria life cycle is false? In zoospores form in the sporangia. The sporophyte is the 2n plant. The gametophyte is diploid. Both the gametophyte and sporophyte stages are multicellular.
Match the terms with the most suitable description. ____ ovule a. pollen tube together with its contents ____ receptacle b. consists of seven cells, one with two nuclei ____ double fertilization c. after fertilization, develops into a seed ____ anther d. embryonic shoot ____ plumule e. pollen sacs inside ____ mature female gametophyte f. swollen stem; base of flower ____ mature male gametophyte g. formation of zygote and first cell of endosperm
In flowers, the structures that produce male gametophytes are called _______ ;the strcutures that produce female gametophytes are called _______ . a. pollen grains; flowers c. anthers; stigma b. stamen; carpels d. megaspores; microspores
Sketch a seed of a gymnosperm and of a monocot. Label the embryo, seed coat, and nutritive tissue (giving its specific name). Indicate the ploidy of each structure (haploid, diploid, or triploid).
PLANT VOCABULARY DOMINANT GENERATION Sporophyte/Gametophyte CELL TYPE IN ADULT ORGANISM Haploid = Diploid= VASCULAR TISSUES PRESENT Phloem = Xylem = MALE SEX CELLS/IS WATER NEEDED? Pollen = Anther = FEMALE SEX CELLS FLOWERS? Ova = Ovary = SEEDS "NAKED" OR IN FRUIT? Seed = Fruit= ROOT SYSTEM PRESENT AND TYPE? Rhizome Tuber Coniferophyta hour IN COVAS 150 XXX11 Monocot VEZIR 03 Eudicot