Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: Explain why RISC binds to a specific mRNA. What type of bonding occurs?

A: The gene expression regulation in a cell to inhibit the expression of particular genes is called…

Q: Draw the mechanism for 5’ capping of mRNA by the associated enzymes (RNA Triphosphatase, RNA…

A: Capping is done in eukaryotic mRNA to prevent the degradation from nucleases. It also assists in…

Q: Describe the various post-transcriptional and post-translational modifications that occur during the…

A: Post-transcriptional modifications are those modifications that occur after the completion of…

Q: Explain the functional roles of the A, P, and E sites during translation.

A: In molecular biology, translation is a process in which ribosomes in the cytoplasm or endoplasmic…

Q: Describe the role Ef-G-GTP has in elongation during translation.

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: What mRNA is most obviously essential in coding proteins, list and describe two classes of…

A: RNA is an intermediate between DNA and proteins.

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: Explain how sequences within the RNA determine where splicing occurs.

A: Transcription is a process that converts DNA into mRNA in the nucleus. *Mature mRNA will be…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form…

A: Step 1 The Shine-Dalgarno sequence is a ribosome binding site in bacteria and archaea messenger RNA…

Q: During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how…

A: The pre-mRNA is composed of two regions, one is the intron, and the other is the exon. The…

Q: Draw the complete structure of RNA dinucleotide 5'-CU-3' (cytosine-uracil) with a 7-methyl guanosine…

A: In eukaryotes, mRNA molecules undergo modifications after the synthesis. The RNA produced during…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: A hypothetical tripeptide Leu-Leu-Leu could be synthesized by the cell. What three different base…

A: Nucleic acids are made up of nucleotides. Ribonucleic acid and Deoxyribonucleic acid are polymers…

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

A:

Q: Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key…

A: mRNA which stands for messenger RNA is a molecule responsible for production of amino acid chain…

Q: Explain the function of 7-methyl guanosine at 5' end of RNA transcript during initiation of…

A: After transcription, when the primary transcript has just been formed, it undergoes post…

Q: Using what is known about the location of introns, a methylguanosine cap, and a poly-A tail, the…

A: Answer.  In eukaryotes, transcription, and translation take place in different compartments of…

Q: Explain the structure of the methylated cap at the 5′ end of eukaryotic mRNAs.

A: Introduction: During DNA transcription and its conversion to RNA, the first nucleotide of this RNA…

Q: Splicing machinery must recognize three portions of the precursor RNA molecule: the 5’ splice site,…

A: The spliceosome, a huge ribonucleprotein complex, is responsible for removing introns from…

Q: Describe the recognition process by which the tRNA for Nformylmethionine interacts with the portion…

A: N-formylmethionine is a derivative of the amino acid methionine in which a formyl group has been…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: The pioneer round of translation of an mRNA is very important to identify potentially dangerous…

A: The pioneer round of translation is a crucial step in identifying potentially problematic mRNAs.…

Q: How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?

A: A ribosomal binding site is a sequence of nucleotides upstream of the start codon of an mRNA…

Q: Describe the significance of a 5 cap poly A tail on the mature mRNA

A: mRNA- is a coding sequence of a gene implicated in the synthesis of protein, approximately, 4% of…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…

Q: Describe the function of the following RNAs. (i) mRNA (ii) piRNA

A: Introduction :- Ribonucleic acid is a polymeric molecule that plays a variety of roles in biology,…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.