Describe the mutation that created the Hbs allele: type of mutation, location of mutation on HbA sequence (#of bases from beginning of sequence), nucleotide change (from which base to which base?)

The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Align two sequences: horizontal – GGAATGG, vertical – ATG, m=1, mm = 0, g=-1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). 0000 Align and score 4 optimal alignments here. the first line, v sequence in the second line and Each alignment should have h sequence individual scores for each alignment position in the third line.

The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as:   Question 19 options:   LINE & SINE/Alu sequences   LINE sequences & IS elements   transposons & LINE sequences   transposons & retrotransposons   SINE & Alu sequences

You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codons

Explain the relationship among the following terms: genomics, proteomics, gene, protein, genotype, and phenotype. minimum of 500 words please!

Determine which primer pair is the best choice. Explain why the other primers are not good choices. Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: 5' gaaataattttgtttaactttaag 3' Tm= 5' gtttaagacaaaatagtctgg 3' Tm = 5' gtaactcagetttcaggtcg 3¹ 5' tctcggaatgttgcaacage 3¹ 5' agattageggatcctacctg 3' 5' atgtgtaatcccagcagcag 3¹ Tm= Tm= Tm= Tm = 5' cattgattatttgcacggcg 3' Tm= 5' aaaatettctctcatccgcc 3' Tm= 5' tccataagattagcggatce 3' Tm= 5' tgcaagettggetgttttgg 3² Tm= 5' gatectacctgacgcttttta 3' Tm= 5' aaataatgaattegagctcggt 3' Tm= 5'ataaaaaaatcgagataaccgtt 3' Tm = 5'aggtcgactctagaggate 3' Tm= 5' tccataagattagcggatce 3' 5' tctcgcatgggggaccccac 3' 5'ctacctgttccatggccaac 3' Tm= 5' ttcgggcatggcactcttg 3² Tm= Tm= Tm =

When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in gaps. Explain why. Discuss twochanges (i.e., two types of mutations) that could happen during theevolution of homologous genes that would explain the occurrenceof gaps in a multiple-sequence alignment.

Generally speaking, a nucleotide substitution has more severe consequences than a nucleotide addition/deletion. True False

Please provide answers of both parts ..