Describe the inheritance pattern of maternal effect genes. Explainhow the maternal effect occurs at the cellular level. What are theexpected functional roles of the proteins that are encoded bymaternal effect genes?

Q: Discuss the similarities and differences between the bithorax and Antennapedia complexes in…

A: The Hox genes were initially discovered in Drosophila and they exist in two separate gene clusters…

Q: Using coat color in mice and the development of female honeybees as examples, explain how dietary…

A: The inheritance of phenotypic characteristics without any changes at the genetic level is called…

Q: You isolate a glp-1 mutation of C. elegans and discover that the DNA region encoding the spatial…

A: Maternal effect genes are the genes present in the genome of the mother and are responsible for the…

Q: Describe three types of genetic changes that commonly convert aproto-oncogene to an oncogene.…

A: The genetic alteration results in the advantage in growth of the cell. The 3 genetic change…

Q: Why are diseases due to microsatellite amplification, even though they have a monogenic pattern of…

A: The classical inheritance is the type of inheritance pattern in which mendelian laws are followed…

Q: Explain how epigenetic modifications are involved in developmentalchanges that lead to the formation…

A: Epigenetics can be defined as the study of heritable phenotype changes that do not involve any…

Q: In general, explain how epigenetic modifications are an important mechanism for developmental…

A: Epigenetic modifications, in general, involve reactions or processes that alter chromatin structure…

Q: Identify the two general functions of the proteins encoded bytumor-suppressor genes.

A: Gene is the unit of heredity that is transferred from a parent to offsprings. Proto-oncogenes are…

Q: Describe the inheritance pattern of maternal effect genes. Explainhow the maternal effect occurs at…

A: Introduction  The life starts from single cell called Zygote. A zygote is formed by the fusion of…

Q: In a Ccpp individual, which functional enzyme ismissing? Is it the enzyme encoded by the C or P…

A: Recessive Allele is the result of a loss of function mutation.

Q: Explain how coat color in mice is epigenetically modified by dietary factors.

A: Epigenetics is the study of heritable changes in gene expression that do not involve changes to the…

Q: B. Briefly describe how can RNA seq be used to quantify differential gene expression between two…

A: It is attainable by performing RNA-Seq with spike-ins, samples of ribonucleic acid at identified…

Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…

A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…

Q: Explain the Comparison of the regions of human NF1 protein and S. cerevisiae Ira protein that shows…

A: Huge amounts of sequences of DNA have already been determined. The pace at which fresh sequences are…

Q: Would the pattern of segment-polarity gene expression be normal if one or more gap genes were not…

A: Segment polarity are required for patterning within each embryonic segment and mutations in genes…

Q: How does the array of transcripts differ between tissues located in different regions of the embryo,…

A: Human genes have multiple transcription start and polyadenylation sites, as well as alternatively…

Q: Using coat color in mice and the development of female honeybees as examples, explain how dietary…

A: Epigenetics is a state of gene expression where there are no changes in the DNA sequence but the…

Q: During certain stages of development, the requirement forcertain gene products may require gene…

A: A gene is a stretch of nucleotides present in the DNA. It codes for the synthesis of an RNA or…

Q: What DNA chemical modification can change the expression level of a target gene without sequence…

A: Introduction Epigenetics refers to the heritable or non-heritable changes in gene expression,…

Q: D. In mice, the Igf2 gene inherited from the mother is never expressed in her offspring? Explain.…

A: Determine: How lgt2 Gene inherited from mother never expressed in her offspring. What gene deleted…

Q: Explain The eyeless/Pax-6/AN gene is crucial for eye development?

A: The eyes are the visual organs of the body. They absorb light and change it into electro-chemical…

Q: Explain Mutagenesis screens for maternal effect and zygotic lethal mutations?

A: The screen that is used in laboratory procedure to create or detect a mutant organism is called…

Q: Some cancers are consistently associated with the deletion of a particularpart of a chromosome. Does…

A: Proto-oncogenes are normal genes that encode for proteins required for the promotion of cell cycle.…

Q: Describe how mutations in genome maintenance factors promote tumorigenesis. Why would inactivation…

A: The cells are basic units of life. When any mutation in the gene takes place due to any radiation or…

Q: Let’s suppose a mutation removes the ICR next to the Igf2 gene. Ifthis mutation is inherited from…

A: Igf2 gene is the Insulin-like growth factor 2 resides on chromosome 11 and is a protein hormone.…

Q: What are the three key processes that Pmar-1 activates in the micromeres? Explain the importance of…

A: Micromere is a small form of the blastomere, which is formed as a result of unequal cleavage of a…

Q: Which tissue in the human body is the CFTR gene most expressed?

A: Introduction The CFTR gene encodes a membrane protein and chloride channel in vertebrates called…

Q: Distinguish among maternal effect genes, segmentation genes, and homeotic genes in Drosophila.

A: The pattern along the eventual head to tail (antero-posterior) axis of the flies Drosophila…

Q: Why don’t all loss-of-function mutations that are recessive at the cellular level behave as…

A: Loss of function mutation refers to the mutation in a gene that leads to reduced or no function of…

Q: A p53 knockout mouse in which both copies of p53 are defectivehas been produced by researchers. This…

A: p53 is a gene that makes protein call tumor protein and it acts as tumor suppresor.  It is found…

Q: You isolate a glp-1 mutation of C. elegans and discoverthat the DNA region encoding the spatial…

A: The genome is made up of one to several long DNA molecules, and mutations in these molecules can…

Q: Describe the mechanism of genomic imprinting of the Igf2 gene in mammals.

A: Genomic imprinting is an epigenetic form of gene regulation. This results in the function of only…

Q: Explain why loss-of-function hedgehog and smoothened mutations yield the same phenotype in flies,…

A: The Hedgehog signalling pathway is responsible for transferring information to embryonic cells.…

Q: Explain the Retrotransposons—the Copia –White-Apricot System in Drosophila ?

A: In Drosophila the w(a) allele differs from the red-eye gene (w+) by the insertion of the…

Q: For the Igf2 gene, where do de novo methylation and maintenancemethylation occur?a. De novo…

A: Igf2 gene in mammals is responsible for imprinting of genes where the offspring is allowed to…

Q: Explain the signaling mechanism of retinoic acid, the source of retinoic acid in vivo, and how…

A: Retinoic acid (RA) is a derivative of vitamin A, also called Retinol. It is known to play various…

Q: A mutation occurs in the Drosophila doublesex gene that prevents Tra from binding to the dsx RNA…

A: Any alternation in the sequence of nucleotide in the genome of any organism is said to be mutation.…

Q: What would be the effect of deleting the toll gene in Drosophila embryos?

A: What are toll genes? Toll is a maternally required Drosophila gene that encodes a transmembrane…

Q: GGGAGTGTATACGGGATGAAGGCATT MRNA: Protein And the phenotype?

A: Proteins are translated from mRNA which result into specific functions or phenotypes.

Q: which specifies an inactive ASIP protein, and for the Kb allele of gene K, whose product is a…

A: ASIP (Agouti signaling protein) is an antagonist of MC1R (Melanocortin 1 receptor). MC1R is a G…

Q: Why did the mouse Pax6 gene produce fruit fly eyes instead of mouse eyes?

A: Drosophila melanogaster (fruit fly) has eyes that are abnormally big and typically brightly colored.…

Q: Describe and compare the structural features of Ig genesuperfamily constant and variable domains.

A: Immunology is the branch of medical science that deals with the study of the immune system and…

Q: How is the alternative splicing of Robo3 temporally regulated during midline crossing?

A: Alternative splicing is a mechanism which increases the complexity of gene functions in many…

Q: Explain Sex-specific splicing of the primary fru transcript.?

A: Drosophila melanogaster is a common fruit fly. It is most common subject used in majority of genetic…

Q: Define the epigenetic mechanisms - chromatin remodeling bythe addition or removal of chemical groups…

A: Introduction  Expression of gene is highly under control by various mechanisms such as histone…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.