Define about cis-regulatory sequences on the mRNA ?

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: Define the glutelin gene promoter (Glu) ?

A: A group of prolamin proteins that are majorly found in the endosperm of various seeds of grass…

Q: Explain how the translation and degradation of an mRNA may be controlled by RNA-binding proteins.

A: mRNA or messenger RNA (Ribonucleic acid) is bound by many RNA-binding proteins throughout its…

Q: Describe the synthesis and processing of mRNAs.

A: ANSWER;- mRNA is "courier" RNA. mRNA is synthesized in the core utilizing the nucleotide arrangement…

Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…

A: The genetic code can be defined as a set of specific rules for a living cell to translate…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…

A: The genetic information flows from the form of DNA into the form of protein and this framework is…

Q: Is there any complementarity between DNA and a transcribed mRNA? In which direction is the mRNA…

A: The transcription is a process by which mRNA is produced from the DNA. In case of prokaryotic…

Q: Define about steady-state level of an mRNA ?

A: Answer- The mRNA is produced by the process of transcription reaction that happens in the nucleus of…

Q: transcription and translation. What

A: Transcription is the process of copying a gene's DNA sequence to make an RNA molecule and…

Q: Name the three main stages of pre-mRNA processing. Explain the importance of each of the stages of…

A: Pre-mRNA, or precursor mRNA, is an immature RNA molecule that is transcribed from a gene in the cell…

Q: xplain the events of translation initiation, elongation and termination

A: The translation is the process in which information in the mRNA is converted into amino acids and…

Q: Describe transcription, including the processes of initiation, elongation, and termination.

A: Transcription is one of the processes in central dogma in which information of DNA transcribed into…

Q: Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA,…

A: The synthesis mRNA from double-stranded DNA requires the enzyme RNA polymerase II, this enzyme will…

Q: Explain how mRNA plays a role in all three stages of translation.

A: Introduction: Central dogma is a two-step process and constitutes transcription and translation.…

Q: describe mRNA splicing

A: Introduction: Copying of DNA to mRNA is a process called transcription. Post-transcriptional events…

Q: What is the "genetic code" and what aspect of post translational modification virtually mandates…

A: Genetic code is a set of rules followed by every living cell by which information stored in genetic…

Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…

A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…

Q: Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts.

A: When an RNA transcript is first made in a eukaryotic cell, it is considered a pre-mRNA and must be…

Q: Draw the structural genes of produce Mrna and enzymmes?

A: A structural gene is the gene that encodes for any RNA, enzyme, or protein product other than…

Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?

A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…

Q: list all the steps required for mRNA to be translated into a protein

A: The process by which genetic information encoded in messenger RNA (mRNA) is converted into a…

Q: How to know the sequence of all mRNAs ?

A: For the determination of the gene sequence that is based on the template of mRNA, we need to do the…

Q: ow would you choose where to begin your reading fa sequence in MRNA? Which rule governing the se of…

A: The process of generating a polypeptide chain (protein) from an mRNA sequence is known as…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: Describe how tRNAs function in the context of the ribosome in buildinga polypeptide.

A: The heart of protein synthesis is the translation of nucleotide sequence information in the form of…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: Describe the major structural features of tRNA.

A: Ribonucleic (RNA) nucleic acid, which is of three main types such as mRNA, rRNA, and tRNA and all…

Q: Given the DNA sequence below:        5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’…

A: Transcription is the first stage of gene expression, in which a particular segment of DNA is copied…

Q: Explain how an mRNA specifies the order of amino acids in apolypeptide

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.