Create a function: -that takes a list and an integer v, -and returns the number of occurrences of v in the list. -Add the NPas variable to count how many times the loop executes in the logarithm = the number of times the loops are executed (and display a message). • The main program must generate a list of random elements (give a matrix no need to generate, just create manually), call the function, and display the result. Example: >>> 13 = [52, 14, 14, 8, 85, 69, 1, 77, 94, 96, 51, 65, 35, 32, 87, 92, 74, 47, 27, 88, 11, 11, 26, 14, 100, 37, 62, 3, 63, 5, 20, 53, 28, 10, 43, 16, 94, 6, 82, 49, 74, 55, 89, 97, 12, 38, 72, 94, 3, 77, 42, 26, 25, 16, 89, 10, 8, 63, 93, 77, 68, 56, 74, 46, 54, 50, 80, 33, 69, 95, 2, 79, 73, 6, 31, 41, 38, 81, 88, 12, 39, 77, 49, 30, 18, 22, 40, 40, 12, 51, 69, 32, 76, 77, 90, 60, 41, 12, 30, 65] >>> account (13,6) Number of steps 100 2

What are the essential elements for creating a loop? Determine two circumstances that may necessitate two distinct loop types. Make careful you include explicit information for each situation that show why the various loop types are essential.

SyntaxError: invalid syntax (<string>, line 56)

Write the Java statement to create an instance of a Rectangle with a width of 4 and a length of 8. Edit View Insert Format Tools Table

You have an equation r = 3*x^2 - 7*x+ 14. Write the MATLAB code to create a symbolic plot of x on the horizontal and r on the vertical axis from x = -10 to x = +10. (provide the code that can create the plot. Do not need to attach the plot below) %3D

A wavy line will appear at the cursor's current position in the code editor.

You need to show detail work on how you get the answer.  Dont use answers from other websites please! Please type your answer not picture Convert 25.84375 to binary (maximum of six places to the right of the binary point) View keyboard shortcuts

Please provide a list of the top six reasons why it's useful to understand how compilers work.

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…

Q : Give a detail description of genetic algorithm used in various field.