
Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Please write your own code, put some commentary for my own understanding. Thank you
![Create a function:
-that takes a list and an integer v,
-and returns the number of occurrences of v in the list.
-Add the NPas variable to count how many times the loop executes in the logarithm = the number of
times the loops are executed (and display a message).
• The main program must generate a list of random elements (give a matrix no need to generate, just
create manually), call the function, and display the result.
Example:
>>> 13 = [52, 14, 14, 8, 85, 69, 1, 77, 94, 96, 51, 65, 35, 32, 87, 92, 74, 47, 27, 88, 11, 11, 26, 14, 100, 37, 62,
3, 63, 5, 20, 53, 28, 10, 43, 16, 94, 6, 82, 49, 74, 55, 89, 97, 12, 38, 72, 94, 3, 77, 42, 26, 25, 16, 89, 10, 8,
63, 93, 77, 68, 56, 74, 46, 54, 50, 80, 33, 69, 95, 2, 79, 73, 6, 31, 41, 38, 81, 88, 12, 39, 77, 49, 30, 18, 22,
40, 40, 12, 51, 69, 32, 76, 77, 90, 60, 41, 12, 30, 65]
>>> account (13,6)
Number of steps 100
2](https://content.bartleby.com/qna-images/question/32c13ba7-237d-4629-8f55-05e99d86aab8/60d882df-c0ad-439b-86db-97c6bc48b0ac/r64jog7_thumbnail.png)
Transcribed Image Text:Create a function:
-that takes a list and an integer v,
-and returns the number of occurrences of v in the list.
-Add the NPas variable to count how many times the loop executes in the logarithm = the number of
times the loops are executed (and display a message).
• The main program must generate a list of random elements (give a matrix no need to generate, just
create manually), call the function, and display the result.
Example:
>>> 13 = [52, 14, 14, 8, 85, 69, 1, 77, 94, 96, 51, 65, 35, 32, 87, 92, 74, 47, 27, 88, 11, 11, 26, 14, 100, 37, 62,
3, 63, 5, 20, 53, 28, 10, 43, 16, 94, 6, 82, 49, 74, 55, 89, 97, 12, 38, 72, 94, 3, 77, 42, 26, 25, 16, 89, 10, 8,
63, 93, 77, 68, 56, 74, 46, 54, 50, 80, 33, 69, 95, 2, 79, 73, 6, 31, 41, 38, 81, 88, 12, 39, 77, 49, 30, 18, 22,
40, 40, 12, 51, 69, 32, 76, 77, 90, 60, 41, 12, 30, 65]
>>> account (13,6)
Number of steps 100
2
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps with 1 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Please help me with this 1. Create a t squared tractal 2. create a viscek fractal (comment the code)arrow_forwarddefin Terms : form criticism, source criticism, canonical criticism, Textus Receptus, textual variant, versionarrow_forwardExplain the compiler's structure and how the code may be tested.arrow_forward
- What are the essential elements for creating a loop? Determine two circumstances that may necessitate two distinct loop types. Make careful you include explicit information for each situation that show why the various loop types are essential.arrow_forwardSyntaxError: invalid syntax (<string>, line 56)arrow_forwardWrite the Java statement to create an instance of a Rectangle with a width of 4 and a length of 8. Edit View Insert Format Tools Tablearrow_forward
- You have an equation r = 3*x^2 - 7*x+ 14. Write the MATLAB code to create a symbolic plot of x on the horizontal and r on the vertical axis from x = -10 to x = +10. (provide the code that can create the plot. Do not need to attach the plot below) %3Darrow_forwardA wavy line will appear at the cursor's current position in the code editor.arrow_forwardYou need to show detail work on how you get the answer. Dont use answers from other websites please! Please type your answer not picture Convert 25.84375 to binary (maximum of six places to the right of the binary point) View keyboard shortcutsarrow_forward
- Please provide a list of the top six reasons why it's useful to understand how compilers work.arrow_forwardPython code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…arrow_forwardQ : Give a detail description of genetic algorithm used in various field.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education

Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education

Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON

Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON

C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON

Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning

Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education