Q: Which of the following types of cell is present in the human gastric glands? 1. Mucus neck cells,…
A:
Q: Question 2. What does DNA polymerase need in order to make contact with a replication origin?
A: DNA polymerase an enzyme that can synthesize a new DNA strand on a DNA template is called a DNA…
Q: In human’s farsightedness is inherited by possession of a dominant allele A. If a man who is…
A: ANSWER;-
Q: Which test measures platelet size?
A: Platelets, also known as thrombocytes, are small blood cells that aid in the clotting of blood. The…
Q: 1. Which of the following group is the most common ancestor of humans and all other vertebrates? a.…
A: Transgenic organisms are also known as GMO (genetically modified organism) whose genetic material is…
Q: Is chrysanthemum a perfect or imperfect flower?
A: The name (Chrysanthemum) is gotten from the Greek chryos meaning gold and the anthemon means flower.…
Q: Which are TRUE about assistive listening devices? I. Instruments designed to provide awareness or…
A: ANSWER;-c) I and IV Explain;- An assistive listening device (ALD) is part of a system used to…
Q: Match each glial cell with its function + Schwann cells A. Help circulate cerebrospinal fluid *…
A: 1. B.Form myelin in the PNS 2. A Help circulate cerebrospinal fluidi
Q: The technique used in bacteria for endospore staining can also be used to observe fungal spores.…
A: *Endospores staining is used to recognize presence of spore in bacterial cells This needs staining…
Q: Describe the typical shape and structure of an antibody. Distinguish between antibodies and…
A: Since you've asked many questions, we're only answering the first three for you. If you want any…
Q: Explain why the nucleotide sequence of the same gene that you inherited from your mother and father…
A: we inherit two copies of each chromosome—one copy from your mom and one copy from your dad. This…
Q: Enumerate and briefly describe five developmental processes in the starfish that are similar to the…
A: Introduction The sea urchin and starfish have pinching organs between their spines and tube feet…
Q: Why can alcohol kill bacteria? Explain via proteins.
A: Alcohol kills bacteria through The process called as denaturation. Denaturation takes place when…
Q: Construct a Lineweaver-Burk plot to answer the following questions: (a) What are the apparent KM and…
A: The Lineweavwe-Burk plot is the plot between 1/[V] vs 1/[S]. Km = -1/ x-intercept Vmax= 1/y…
Q: What are the four requirements for chemical evolution, and why is each essential?
A: Chemical evolution can be defined as the changes that occur during the course of development when…
Q: The figure shown is a homunculus of the star-nosed mole. The star- nosed mole has 22 fleshy…
A: Star-nosed moles are not dangerous to humans, but they can cause damage to some landscapes or…
Q: You are a public health official trying to determine the identity of the pathogen circulating within…
A: Answer :- Improvements made in the DNA sequencing innovation prompts the total investigation of…
Q: how mispairing of homologous chromosomes could have led to the formation of a gene that codes for a…
A: *Unequal crossing over occurs when loci is similar in sequence will undergo homologous recombination…
Q: The first step leading to allopatric speciation is (a) hybrid inviability(b) hybrid breakdown (c)…
A: Speciations are the process in which species evolve into something so drastically different than…
Q: hat are the Similarities and differences between meioses and mitosis?
A: Cells are the fundamental building blocks of all living things and are usually found at the very…
Q: Which test measures measures the number of erythrocytes in blood?
A: Erythrocytes : It is a red blood cell ,biconcave, enucleated,contains haemoglobin pigment which…
Q: Describe 3 biomechanical factors that influence muscle force production. Be sure to explain how or…
A: Muscle force production is the amount of force (maximum) that skeletal muscles can produce. It is…
Q: 3. The fact that the CRA will spontaneously give up its electrons after a certain amount of time…
A: Oxidase test It is a test used to determine the organisms can produce cytochrome oxidase c or not.…
Q: Describe the following general characteristics that can be used to distinguish among Animal phyla:…
A: Kingdom Animalia is a kingdom which consists of multicellular , Eukaryotic organism . It is…
Q: In human body, the digestion of protein begins in which of the following organs? 1. Liver 2. Mouth…
A: The correct option is stomach.
Q: Where did eukaryotes come from?
A: Introduction The origin of life on earth can be traced back to 3.4 billion years ago and as we now…
Q: Name the components of the formed elements in the blood and mention one major function of each of…
A: Blood is a fluid connective tissue it is composed of plasma and formed elements or blood corpuscles.…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Compare the prebiotic soup hypothesis with the iron–sulfur world hypothesis.
A: Both prebiotic soup hypothesis and iron sulphur world hypothesis were given by different scientists…
Q: Which meristem, mainly found in the shoot and roots tips, is responsible for primary growth? Read…
A: apical meristem, region of cells capable of division and growth in the root and shoot tips in…
Q: p + q = 1 p2 + 2pq + q2 = 1 p is the frequency of the dominant…
A: The Hardy-Weinberg equilibrium states that the frequencies of alleles and genotypes in a population…
Q: 4.What is the fate of the fertilized ovule of a flower? Read and analyze the question and choices…
A: Flower is most conspicuous , fascinating, fragranted part of plant and is major characteristic of…
Q: discuss the relative advantages and disadvantages of light and electron microscopy. how could you…
A: A microscope is a device used to observe microscopic organisms that are invisible to the naked eye.…
Q: Decellularization of Porcrine Heart Valves” , what is its benefits ? and how it is used ? Its…
A:
Q: • List 4 sources of genetic variation and explain how each source contributes to genetic variation •…
A: Population evolution Evolution is a prpcess of change and adoption for better survival in the…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: The digger bee’s “postcopulatory courtship” consists of elaborate tactile stimulation that the male…
A: The digger bee’s “postcopulatory courtship” consists of elaborate tactile stimulation that the male…
Q: Which is considered as the plant's first line of defense against physical damage?Read and analyze…
A: A plant's first line of defense against infection is the physical barrier that is in the epidermis…
Q: Write short notes on the functions of the following hormones: (a) Parathyroid hormone (PTH) (b)…
A: (a) Parathyroid hormone (also known as PTH) (PTH)l Its primary function is to raise the amount of…
Q: Tawilis is a freshwater sardine endemic only in the Taal Lake in Batangas province. After several…
A: Tawilis is believed to be a marine fish and has been adapted to freshwater ecosystem. This…
Q: Which among the following is NOT a principle of natural selection? a. The genes produced are a…
A: According to the theory of natural selection given by Darwin it is said that nature selects the best…
Q: To which of the following does the "tissue level" of structural organisation refer? A. atoms, ions,…
A: The correct option is D.
Q: What is the importance of plasma proteins?
A: Introduction In this question we will discuss about the importance of plasma proteins.
Q: The presence of freckles is a dominant trait. Cross a heterozygous freckled man with a nonfreckled…
A: Introduction : A monohybrid cross is a genetic collaboration of two different alleles which has…
Q: 23. What is the probability that the progeny of a cross between two individuals that are AaBbCCDD…
A: 23) The correct option is B - 1/16
Q: Which test measures percentage of hemoglobin within each red blood cell?
A: Haemoglobin, Hb is the iron-containing oxygen-transport metalloprotein in red blood cells. It is…
Q: the function of the Osteocyte is- .A support .B blood supply to the bone .c Nourishment .D All…
A: The hardest connective tissue comprising of calcified matrix and which forms the skeleton of the…
Q: Diffusion of gases occurs in the alveolar region only and not in the other parts of respiratory…
A: Each alveolus is composed of a thin layer of squamous epithelial cells that are highly permeable and…
Q: .In which zone do cells fully mature into their distinct cell type?Read and analyze the question and…
A: In meristematic zone, rapid mitosis of undifferentiated cells take place. Root cap protects the…
Q: When a salmon or other teleost fish migrates from seawater intofreshwater, what are all the changes…
A: Teleosts are members of the Teleostei infraclass, which contains 96 percent of all extant fish…
Could hawthorn and apple maggot flies be considered an example of assortative mating? Explain your answer
Step by step
Solved in 2 steps
- EVOLUTION LINK Could hawthorn and apple maggot flies be considered an example of assortative mating, which was discussed in Chapter 19? Explain your answer.In some animal species, being tall is dominant over being short. If a homozygous dominant individual mates with a short individual, what is the chance that their offspring will be heterozygous?How is the frequency of cotransduction related to the relative position of genes on a bacteial chromosome? Draw a map of three genes and describe the expected relationship of cotransduction frequencies to the map.
- Please discuss the fitness advantage associated with aiding a related or even an unrelated individual with producing offspring. Please give examples.What is an interrupted mating technique ?Salamanders have a male heterogametic system for sex determinations where females are ZZ and males are ZW. The allele for the color of the tail is sex linked and the red allele is found on the W chromosome and the blue allele is found on the Z chromosome. You mate a male and female and they have 3 female offspring. What is the phenotypic ratio for tail color for their offspring? Group of answer choices 2 Blue : 1 Red 0 Blue : 3 Red 1 Blue : 2 red 3 Blue : 0 Red
- A dairy farmer chooses to mate a male bull only with the female heifers that always make the greatest amount of milk, rather than heifers that produce a small amount of milk. What process is the dairy farmer employing when producing the next generation of calves?A Labrador retriever breeder tried to get brown and yellow puppies. She crossed a yellow female labrador with a brown male. To her surprise all the puppies came out black. Explain why this is seen. What are the chances that she will have yellow puppies if she mates two brown Labrador retrivers? Show your work.Give two example of in-breeding?
- What is a mating between relatives?Read in your textbook about positive assortative mating. In this example, from your text, positive assortative mating is 100% (i.e. there is no random mating). Note that the frequency of heterozygotes is cut in half each generation. Does this match your answers above? Look at the actual values make sure you understand why positive assortative mating leads to an increase in homozygosity. (a) Only heterozygotes produce heterozygote offspring, but only 50% of the time Homozygote parent for A, Heterozygote parent Homozygote parent for A, Eggs A, A, Eggs A2 A, Eggs A2 A2 A, A, A, A, A, A, A, A, A, A2 A2 A2 A2 A2 A2 A, A, A, A, A, A, A, A2 A2 A2 A2 A2 Az A2 A2 (b) Effect of extreme inbreeding (self- fertilization) over time A, A, Homozygote A, A2 Heterozygote A2 A2 Homozygote The arrows represent A, p= 0.5 offspring genotypes that are produced by each parental genotype Generation 1 Az q = 0.5 100% 25% 50% 25% 100% A, p= 0.5 Az q= 0.5 Generation 2 100% 25% 50% 25% 100% The frequencies of…Use the figure and the following description to answer the question(s) below. In a particular plant, leaf color is controlled by gene locus D. Plants with at least one allele D have dark green leaves, and plants with the homozygous recessive dd genotype have light green leaves. A true- breeding, dark- leaved plant is crossed with a light- leaved one, and the F1 offspring is allowed to self- pollinate. The predicted outcome of the F2 is diagrammed in the Punnett square shown in the figure, where 1,2,3, and 4 represent the genotypes corresponding to each box within the square. D d D 1 2 4 Which of the boxes marked 1- 4 correspond to plants with a heterozygous genotype? 2 and 3 1 1,2, and 3 2, 3, and 4 3.