Cleavage is a unique type of cell division that occurs ____

Q: Artificial insemination

A: Reproduction is the process of production of own kids by living beings.

Q: Stages of Meiosis

A: Meiosis is the process of cell division by which a diploid cell divides to form haploid gametes. In…

Q: <BCDEL O

A: In human , there are a pair of kidney which helps in filteration and removal of waste material out…

Q: Define cleavage furrow

A: Cleavage furrow is formed in the cell when during cell division, the cytoplasm of the cell divides…

Q: ohubrıd with crosses

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: X-linked diseases

A: X-linked recessive conditions include red-green color blindness and hemophilia A: Red-green color…

Q: Homozygous dominant

A: Homozygous means same type of alleles.   Dominant means with dominant alleles which express.

Q: MEIOSIS 2nn FERTILIZATION

A: The above diagram represents the life cycle of angiosperms

Q: Label name biology

A: Introduction: The respiratory system constitutes a group of organs concerned with breathing…

Q: There are 5 primary oocytes that will undergo cell division, How many functional secondary oocytes…

A: BASIC INFORMATION  OOGENESIS It is the formation of mature female gametes. This process is…

Q: nd reproductive s

A: 1 -Human fertilization and development. 2 Parthenogenesis. 3 Parthenogenesis in animals means the…

Q: Child birth What is stimulus.

A: child birth is the process by which developing fetus is coming out of the womb of the mother as it…

Q: sive a note on Bateriophege.

A: Bacteriophages are virus that can infect and kill a bacterium. It is also known as bacterial…

Q: What stage cancer did the football player alfonso have?

A: Cancer is the uncontrolled division of cells. It has four stages. Some cancers have zero stage too.…

Q: li fraumeni syndrome history 2. How it is linked with genetics

A: Autosomal dominant diseases are those that affect both parents when the child is affected by the…

Q: Discuss the phases of mitosis and meiosis in detail.

A: Cells in the living organisms divide in order to grow in number. In humans or other organisms that…

Q: Analyze the karyotype shown. Indicate if it is a chromosomal male or achromosomal female. If the…

A: Every species have a characteristic number of chromosomes. An organism may contain one set x…

Q: shown in this figure is: Male O Female

A: From external inspection, the presence or absence of external genitilia mainly denotes the maleness…

Q: Identify if the description below happens in meiosis, mitosis, or both

A: Mitosis is an equational division in which a parent cell (2n) is  divided into two daughters cells…

Q: In a 24-year-old man, which of the following cell types are most likely to be in the process of…

A: Testis is the part of male reproductive system. It is found in the scrotum 2gich provides the 2°C…

Q: (b). By using a table, compare mitosis, meiosis I and meiosis II.

A: Introduction :- Meiosis is a two-stage process in which the number of cells doubles but the number…

Q: O anaphase I

A: Spindle fibers  can be defined as the protein structure that divides the genetic material in the…

Q: Expand the term BMI

A: Body Mass Index (BMI) is one of the tools that health professionals use to help assess someone's…

Q: Biology Lab 1 レ

A: Microscopic objects are those which cannot be seen by naked eyes and therefore a microscope is…

Q: Biochemistry Laboratory Repe

A: 1. Blood glucose level of patient is only 58 mg/dl which means patient has hypoglycemia.…

Q: tongue rolling phenotype and genotype

A: Tongue rolling is a dominant trait. A genotype is the genetic makeup of an organism. A phenotype is…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)&gt;copy of gene&gt;protein, this is the…

Q: During third trimester of pregnancy

A: A pregnancy timeline is of 40 weeks. The weeks are grouped and divided into three trimesters. The…

Q: NUCLEUS CAGTTAATGGAG CGATG CCTG GATG GAGAAATCA ATTAG 3 5

A: DNA acts as the genetic material in most organisms. DNA stands for deoxyribonucleic acid. The…

Q: Name of phase of mitosis:

A: A cell prepares for cell division by replicating its chromosomes, segregating them, and creating two…

Q: Infertility Allergic reactions

A: Human body has an excellent system of immune system. We are able to resist the attack of several…

Q: O diploid offspring through mitosis

A: Asexual reproduction is the type of reproduction that involves the use of vegetative parts of the…

Q: O haploid naj

A: Answer is C . Haploid

Q: NAME OF CELL FIGURE

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: Inferior to the umbilical region

A: Human Anatomy is often defined as the study of structures in the human body. Anatomy focuses on the…

Q: Name specific opening "A" micropyle Name specific structure "B" placenta A - MacBc

A: Lilium ovary The ovary contains one or more ovules, which in turn contain one female gametophyte…

Q: seminal vesicle

A: The given figure is of male reproductive system. In this figure the highlighted structure options…

Q: Twins may or may not be identical. Comment.

A: Fertilization is the fusion of gametes to initiate the development of new individual organism or…

Q: Genotype Phenotype | | || From Edward From Jenna

A: Inheritance is passing of character from parent generation to progeny. Genetic makeup of an…

Q: differentiate anaphase I vs. anaphase II

A: The cell cycle/ cell division is the series of events that take place in a cell leading to its…

Q: why are the immature cells important

A: In biology, we believe that cells are the basic building blocks of the life. They are the smallest…

Q: Label image attatched: Frog early cleavage

A: 1) and 2):fertilization membrane…

Q: Which of the structures indicates the site of fetal development? O A O B O D O E

A: The reproductive system of a female gives rise to a new individual and is formed of many parts which…

Q: Characteristics (Manifestations) of-9 life through which we cannot understand the life of living…

A: Any biological, living system that acts as a separate entity is referred to as an organism. Cells…

Q: Contrast mitosis and meiosis, emphasizing the different outcomes.

A: Meiosis and Mitosis are both types of cell division which differ in the type of genetic material…

Q: Genomic islands

A: Genomic islands are regions of large DNA sequences that encode dor accessory genes in a bacteria.…

Q: í autosomal dominant disease ir

A: Autosomal dominant means in the gene located on non-sex chromosome, single copy of…

Q: Select the most accu

A: The basic structural unit of human body is bone. Bone is highly vascular , mineralised connective…