
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
thumb_up100%
Clearly diagram rolling circle replication. Add 5’ and 3’ and show the direction of replication with arrows. Include the part that looks like “Okazaki fragments.”
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps with 1 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…arrow_forwardHow is DNA copied with leading and lagging strands? Please use these terms in a summary: Helicase Decide on the leading vs lagging strand locations Primase on leading strand DNA polymerase Primase on lagging strand Ligase Nucleasearrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…arrow_forwardDraw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends 2. All 5’-phosphate ends 3. leading strand (s) 4. lagging strand (s) 5. Okazaki fragments (draw 3) ❏ RNA primer(s) 6. direction of replication ❏ replisome(s) 7. origin (s) 8. terminus (i)arrow_forwardDescribe how homology-directed repair can repair a collapsed replication fork.arrow_forward
- 9. Below is a schematic of an origin of 3' replication. a) Would replication in the top strand in region 1 be continuous or discontinuous? Region 1 Region 2 b) Would replication in the top strand in region 2 be continuous or discontinuous?arrow_forwardOn paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?arrow_forwardCorrect order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forward
- AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * AA AA AA AA АВ ВА AA BB AA AA AB AC Figure A Figure B Figure C Figure D Figure A Figure B Figure C Figure D AKS 5b: Use the models below to answer the question that follows. Which model and explanation best represents the semiconservative nature of DNA? *arrow_forward1) Fill in the following replication bubble. Be sure to draw and label the origin of replication (both sides), the leading and lagging strands, & the 5' and 3' ends of alI DNA fragments. 5' 3'arrow_forwardDetailed study of the monster Lochnessius coolnameii revealed the following: Characteristic Result Size of nuclear genome 2.04 m of DNA (B-form) Length of mitotic S phase 5 hr Rate of DNA synthesis 2,500 basepairs/min at each replication fork What is the minimum number of origins of replication needed in each cell of this monster?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education