Cells can make the non-essential amino acids. To do so, they need a specific enzyme. Which of the following activates the enzyme that allows cells to make non-essential amino acids? O niacin O iodine ascorbic acid O choline O pyridoxal phosphate

ẞ-Calendic acid is an omega-6, conjugated fatty acid that is the all-trans isomer of a-calendic acid. HOOC—CH,CH, CH, CH,CH, CH, Part: 0/2 Part 1 of 2 H C=C H C-H H-C H C=C H CH₂ -CH2-CH2-CH2-CH₂ When this fatty acid is partially hydrogenated with one equivalent of H₂ in the presence of a Pd catalyst, a mixture of constitutional isomers is formed. Modify the given structure to draw one of these possible products.

Which of the following about the glycosylation of proteins in the ER is false?    Dolichol phosphate serves as a lipid carrier. Oligosaccaryltransferase add the oligosaccharide to the protein.  The oligosaccharide ‘tree’ is made up of glucose and mannose.   Asn-X-Ser/Thr serves as the glycosylation site on the protein.  Carbohydrates are added to the lipid carrier by glycosyltransferases.

Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?