C++ Program to check if a file or more is sorted or not? What would be the best way to check that a file of Numbers is sorted? input : file.txt output: the file is sorted
Q: Create a C++ program that has four options, (1) add a name, (2) search a name, (3) show all names,…
A: C++ is nothing but a general-purpose programming language which is created by Bjarne Stroustrup as…
Q: 2. Printing binary Write a function void printBin(int value) that will print an integer as a binary…
A: Print binary representation of a given number in C, The idea is to check if i'th bit is set for each…
Q: Write a simple C program that can determine whether a machine is little- or big-endian.
A: ANSWER: C Program: The C programming language is PC programming language that was made to do…
Q: Implement the following function in Python. Do not copy the docstring into your answer. Write a…
A: Working Method: Consider the complete file as a single string --> read() method returns the…
Q: Write a C++ program that reads the file that includes numbers and find the Maximum number in that…
A: #include <iostream>#include <fstream> using namespace std; int main(){//create…
Q: Write a function-based C++ program that reads an integer array from a file (“input.txt”) and finds…
A: Modulo(%) operator : The remainder value is obtained when the integer division of numerator and…
Q: In C++ can someone make a code where it reads a txt file and displays the text file that has pending…
A: We have no idea how big the shipping orders txt file is or how much data it contains. As a result,…
Q: Write a C++ program that reads the file that includes numbers and find the Maximum number in that…
A: Find the code implementation below.
Q: For this programming assignment I want you to write a program that calculates bigram frequencies for…
A: Hey there, I am writing the required solution based on the above given question. Please do find the…
Q: For this question please write a basic python code for each point displaying how the concept is…
A: Note: since question contain multiple sub-parts but we can answer only first 3-sub parts at a time…
Q: Write a C++ program oop asks about how are you ? (happy, sad, moderate). if you are happy - it will…
A: Function Overloading: Function overloading is a special feature of C++ that allows two or more…
Q: Create a program and then: Show file input (get your input from a file) File output (output to a…
A: Below i have given code for same:
Q: Make only one text files that include some numbers then Write a C++ program that reads that file and…
A: Q: Make only one text files that include some numbers then Write a C++ program that reads that file…
Q: nt st nat des omnile
A: #include <iostream> using namespace std; // function to convert decimal to binary void…
Q: Is it possible to bubble sort or selection sort or insertion sort string or char[100] for names…
A: Sorting is one of the most basic and useful functions applied to data. It aims at arranging data in…
Q: Using C++ language create a basic while loop with a function code in the program that sums a stream…
A: Code: #include <iostream>using namespace std;int main(){ int num,sum=0;…
Q: Q2: Write a complete C++ program that reads the contents of the text file "mydata.txt", character by…
A: Below is the required C++ program: - Approach: - In the given program two files are open one in read…
Q: Python Question: All file input and output is done with what kind of data?
A: For every program, input and output are necessary in any language. To give input and to get output…
Q: o Write a C program that uses the sizeof operator to determine the sizes in bytes of the various…
A: the code is an given below :
Q: C language Question : What happens if the condition in a while loop is initially false ? What is the…
A: Introduction In this question we have to discuss about the outcome, if the condition in a while…
Q: Merge two files (1 point) Write a program that reads the content of two files “text1.txt” and…
A: Actually, file is a sequence of bytes where related data stored.
Q: to
A: #include <iostream> using namespace std; // function to convert decimal to binary void…
Q: Hi. I made a code but I have to change it. These are the requirements for the program code • Safe…
A: According to the information given:- We have to change the code to fit its requirements.
Q: C++ I want to create a program that reads a text file, but when it reaches a string of words that…
A: Answer: C++ Source Code: Line by Line: Method 1: #include <iostream>#include…
Q: Write a simple C++ program that allows the user to create files of random data. They should be…
A: #include <iostream> #include <cstdlib> #include <ctime> #include<algorithm>…
Q: Write a python program that reads the first n lines of a text file. Suppose you have a file with all…
A: Required: Must show it in Python: Please show step by step with comments. Please show it in simplest…
Q: Rahul created a file and he saved some points from his notes to that file but while saving the…
A: Please give positive ratings for my efforts. Thanks. PROGRAM #include <iostream> #include…
Q: DCP 5101 PROGRAM DESIGN LAB 11 QUESTION 2 Write a complete C program that creates a new file called…
A: #include <stdio.h>#include <stdlib.h> int main(){ char ch; int channel,…
Q: How many loops available in c++ ? Compare the following loops: (a)while loop and do while loop…
A: How many loops available in c++ ? Compare the following loops: (a)while loop and do while loop…
Q: All parts need to be included in the same C file so the new code needs to be added to the existing…
A: C program: #include<stdio.h> void printBin(int value){ int i; // Integer to binary…
Q: In this lab, you open a file and read input from that file in a prewritten C++ program. The program…
A: The given problem is to be solved in C++ programming language where the file is to be read and…
Q: Assume an input file (called "numbers.txt") contains a number on each non-blank line of the file.…
A: Please find the answer below :
Q: Need help with part 2 I was already helped with part one and they told me to repost to get help…
A: Big endian and small endian:- It is two formats for storing multibyte data types in computer memory.…
Q: 1. Write C statements which tests to see if input file has opened the data file successfully. If…
A: the program is given below:- by bartleby guidelines i am able to do only one question
Q: Write C program to solve the flow chart. START Tips: Comment in your program and save Read name your…
A: Logic:- read name, address1 , address2 and display name, address1 and address2. End. Note:-…
Q: Write a simple C program that can determine whether a machine is little- or big-endian.
A: Solution: Little Endian: The little endian show is a sort of addressing that alludes to the request…
Q: would you write the c++ program using this two functions which is written in pseudocode:…
A: File A.txt and B.txt data: Code: #include <iostream> #include <fstream>…
Q: How do you write a code in c++ that gives the user an option to save(write) a program(example the…
A: Here is the C++ program which will take a set of numbers and arrange those numbers in ascending…
Q: The goal for this question: DISCLAIMER****** CODE MUST BE WRITTEN IN C CODE. NOT C++, C#, etc. To…
A: To create a program that MUST utilize the functions (argc, argv, char strstr, and possibly even…
Q: 2. hello world Write a hello.c file that contains two functions. The function sayHello should take a…
A: Please upvote. I am providing you the correct answer below.
Q: Use C++ to read data from a text file and create an array of numbers. Use the C++ 'fstream' library…
A: Actually, array is a collection of elements.
Q: Would you help to create c ++ program counts most 5 repeated words in file. The file can be…
A: Create c ++ program counts most 5 repeated words in file.
Q: write a program in C to create and store information in a text file.
A: #include <stdio.h>#include <stdlib.h> int main(){ char str[1000]; FILE *fptr;…
Q: use user-defined functions. - use an array of arrays. - use file pointers - use string processing…
A: C is an procedural programming language Developed by Dennis Ritche in the year of 1972 It is…
Q: Make only one text files that include some numbers then Write a C++ program that reads that file and…
A: Below is the code in C++ and sample output:
Q: C++ program to find out if a file is sorted or not
A: #include <iostream>#include"sort.h"using namespace std; int main(){ string…
Q: Please give some examples on how to use the following in Python. Please do example codes For/while…
A: Answers: For loop example: #(printing the list of number) List = [10,30,23,43,65,12] sum = 0…
Q: would you write the c++ program which is written in pseudocode: Code 1: input file A…
A: #include <iostream>#include <fstream> using namespace std; bool sort(){ int…
Q: Need help with part 2 I was already helped with part one and they told me to repost to get help…
A: Here we write simple to print number in binary :…
C++ Program to check if a file or more is sorted or not?
What would be the best way to check that a file of Numbers is sorted?
input :
file.txt
output: the file is sorted
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- File Handling with Array: C++ Language: Write a c++ program to read the data from the file into array and do calculation. Note: Take a general word problem which helps in others related questions.c++ program need help You are given a file containing many words. Read in all of the words from the file and insert each word into a searchable ADT. Give the user a looping menu allowing them to search for words in the word list. Searches must be be found in O(1) or constant time. Your code must time the search operations, and display the time to the user. For this assignment, you may use the provided word list or another word list with more than 150,000 words. Include this file with your submission. You must design and implement the following classes: Word: This class holds a single word as a string. Basic getters and setters are required. HashTable: This class represents the hash table for storing many words. Main: This is the driver class. The driver: Create a Hash Table Read in all of the words from a text file into the Hash Table Provide a looping menu for the user to perform searches. Time all searches and display the execution time to the user For each search: Prompt…C++ Programming: Write a C++ program to take input and then make a random swap between any two characters of the string and print the string formed in output. To make random swap generate index using rand() function.
- QT: write a program in C++ to ask the user to enter five complex numbers in a file called (complex.txt). The real value and imaginary value of each complex number should be stored in a single line separated by a tab (\t). This functionFile Handling with Array: C++ Language: Write a c++ program to read the data from the file into array and do calculation. Note: Take a general word problem and write syntax which will use in all problems related to file handling with array.a C++ program that creates a two-dimensional integer array (4x3) initialized with user given data. The program should have the following functions: • Print the sum of all values in the array. • Print the average of all the values in the array. • Take row number from user and print the sum of the values in that specified row.(use loop and no if statement) • Take column number from user and print the sum of the values in that specified column.(use loop and no if statement)
- C++ Problem!! Sort A List Of Integers Given a file of 100,000 unsorted integers, write a program that first prompt user to enter file name and reads those integers into an array and sorts the integers in the array. The program should then prompt the user for an index, and then display the integer at that index. For example, if the array contains ten integers and the contents are 79 4 42 51 12 22 33 17 91 10 after sorting, the integer at index 6 is 42 Download the "List of 100,000 Unsorted Integers" from below link and sort that list, then enter the value at index 10000 (ten thousand) for a screenshot. https://1drv.ms/t/s!AuFS4mkcuYyBjHZ_SIudb93bq2uy?e=CsyvZjC++ Programming: How would you write a function that takes a filename and an array of struct time, opens a file, reads each line in the file as the number of days, converts this to a struct time and stores this is in an array? Here is my code so far (p.s. the function i need help with is called void readData): #include<iostream>#include<string>#include<fstream>#include<cstdlib>#include<vector> using namespace std; struct time{// private:int years, months, days;//public: time(){}time(int days){}}; time getYearsMonthsDays(int days){time x;x.years = days/450;days = days%450;x.months = days/30;x.days = days%30;return x;} int getTotalDays(time x){int totalDays;totalDays = x.years*450 + x.months*30 + x.days;return totalDays;} void openofile(string ofilename,ofstream &fout){fout.open(ofilename.c_str());if(!fout){cout << "Error opening output file..." << endl;exit(1);}} void openifile(string ifilename,ifstream…C++ program to find out if a file is sorted or not? Using header file
- *Coding language is Python Write a program that opens the productsales.txt file and reads the sales into a list. The program should output the following information, in this order: The total of all sales in the list The average of all sales in the list The lowest sale in the list The highest sale in the list NOTE: Your program should include at least one user-defined function, in addition to the main function. 4147 1594 2235 8433 10000 129 5555 7030 9764 7465 1111 4444 8954 2243 2895 1436 4978 5486 1436 9846 4789 8456 2497 2280 6375C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…C++ program to find out if a file is sorted or not? Using header file The “sort.h” contains the Boolean method that check the file are sorted or not and return true. The “sort.h” is included in the main.cpp.
