The mutant genes for vestigial wings and singed bristles are approximately 30 map units apart on chromosome II in Drosophila. Assume that a vestigial-winged female was mated to a singed-bristle male, and that the resulting F1 phenotypically wild type females were mated to vestigial singed males. Of 1000 offspring, which phenotype class would represent the product of crossing over between the genes, and how many would you expect? a) vestigial, 300 flies b) vestigial, 150 flies wild type, 300 flies d) singed, 150 flies e) vestigial, singed double mutants, 150 flies

Q: 1.4 If galangin were tested, how would its antibacterial activity compare to that of the other…

A: Flavanoids are commonly seen in the plant kingdom and they are heterocyclic compounds. They can be…

Q: Chromosomes per cell Chromosomes status DNA (molecules) per cell DNA picograms per cell Ploidy G1…

A: Cell division is a process in which parent cell ( main cell ) undergo splitting and gives rise to…

Q: What size circuit can be analyzed with circuit theory if the electrical energy exciting the circuit…

A: Circuit theory is the study of the behavior of electrical circuits. It can be used to analyze and…

Q: Why does puberty occur too late or too early in some individuals?

A: The body's normal process of sexual maturity is known as puberty. The hypothalamus, a small region…

Q: Put the following hierarchical levels in the correct order representing the structured organization…

A: Introduction The level of organization of biological refers to the complexity of the various…

Q: Besides agarose gel electrophoresis, there is also SDS-PAGE (sodium dodecyl sulphate- polyacrylamide…

A: To separate DNA, RNA, or protein molecules according to their size and electrical charge, a…

Q: What is the map distance between the two rapid lysis mutations re and rf given the data below? 2…

A: Hint: Always less numbered progeny becomes recombinants. In the question given that, re- rf- X r+…

Q: Define the differences between tendons and ligaments.

A: Introduction To maintain the proper shape, structure, and integrity of the body, specialized tissue…

Q: 12.In a zygote that begins with a complement of two homologous chromosomes pairs, A and a, and B and…

A: Introduction :- A gamete is a female or male sperm or an egg cell, to put it simply (male gamete).…

Q: Discuss how assortative mating can influence genotype frequencies. Are there any potential…

A: Introduction Assortative mating sometimes referred to as "non-random mating" is a type of sexual…

Q: Carnivore Herbivores Producers 2gm/m 8 gm/m² 4/gm/m² Inverted Pyramid in an Aquatic Ecosystem

A: Introduction :- Inverted pyramids are pyramids with a wide top and a narrow base.It indicates that…

Q: What steps are necessary and unnecessary for non-protein coding genes?

A: The translation is the process of analyzing the mRNA message in order to produce a protein. It is…

Q: Why is an early diagnosis of developmental dysplasia of the hip imperative?

A: Diagnosis means finding out the disease by the sign and symptoms of the patient or by a diagnostic…

Q: CRITERIA MITOSIS MEIOSIS a.    chrosomosomes number of daughter cells     b.    number of cell…

A: Mitosis is also known as equational division because the number of chromosome remains the same from…

Q: 14. Other than bacteria list the other 6 types of Microorganisms listed in your textbook.asap

A: We know that Microorganisms are the smallest life forms on our planet. They are not visible from our…

Q: 3. Describe the location and structure of taste buds.asap

A: Introduction :- On the tongue, there are tiny sensory organs called taste buds that communicate…

Q: In a 50 square mile section of forest, there are some cut patches of forest where the trees have…

A: A scientific method is a systematic approach to a scientific study. It was developed in the 17th…

Q: True or false. The cell walls of plants prevent the process of cytokinesis.

A: Cytokinesis is the process by which one cell physically divides into two cells.

Q: In a species of dog, plaid color is represented by P and purple by p, short -tailed is T and…

A: Although the phrases genotype and phenotype may look similar, they are very different from one…

Q: 12 13 14 Which of the following is true of a somatic mutation? A. They are mutations passed on to…

A: a DNA change that takes place after fertilisation. Somatic mutations can occur in every cell of the…

Q: In dioecious plants, males usually produce larger flowers that attract more pollinators than do…

A: Answer: Dioecious plants : These are the plants which are having only either female reproductive…

Q: Why is it important to study evolution?

A: Change in the inheritable traits of biological populations over successive generations is referred…

Q: Question 2 Describe how DNA polymerases achieve processivity in prokaryotes.

A: Introduction :- Prokaryotes are creatures without a nucleus or other organelles in their cells.…

Q: phase best describes the major process compon evolution? natural selection O adaptation O survival…

A: Ans: Charles Darwin the British naturalist gave the theory of biological evolution. He defined…

Q: You should always position the cells or tissues in the center of view before increasing…

A: It is important to position the cells or tissues in the centre while viewing under a microscope…

Q: Which of the following accurately represents proper genotypes for a dihybrid cross? Group of answer…

A: These options represent different types of crosses. In genetics on the basis of the characters or…

Q: Q1 Based on the above plot, the maternal heritability value of human height is 0.566/2. (True or…

A: The metric that asses the variance of a trait in a population is known as heritability. The…

Q: Describe the inflammatory lesion associated with lupus erythematosus.

A: Lupus erythematosus is an autoimmune inflammatory disease. In this disease immune system attacks its…

Q: A. B. C. D. ATGTTCGCG What type of mutation is seen in this example? Substitution point mutation…

A: Q8. Mutation is a change in the sequence of DNA. It can result due to errors during replication of…

Q: Regulated reabsorption of Na+ at the DCT occurs under the influence of the hormone

A: Introduction Kidneys are small bean-shaped organs present in the lower abdomen of the human body.…

Q: L. B cells are most important in the immunity type of

A: Introduction Our body has a special defense mechanism that prevents and fights infection or disease,…

Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…

A: Introduction :  A set of macromolecules known as vitamins perform a variety of biological activities…

Q: Can you show me the cross and how to get the answers

A: The leaves of the 4-o'clock plant might be green, variegated (white and green), or white. Different…

Q: Describe the radiation in vertebrate forms from phylotypic stage by focusing on three groups of…

A: Evolutionary radiation increases biological diversity and is caused by various factors of which one…

Q: Distinguish between prokaryotic and eukaryotic cells in terms of presence or absence of a nucleus,…

A: Cell is the smallest and living part of animal and plant . It is two types prokaryotic cell and…

Q: Health Information Management

A:

Q: What kind of ailment can algal (algae) toxins cause? a. disease caused by a neurotoxin b. anthrax…

A: Introduction  A toxin is an organic poison that occurs in nature and is created by the metabolic…

Q: True or false. The cell walls of plants prevent the process of cytokinesis.

A: In order to separate daughter nuclei after mitosis, a new cell wall must be formed and inserted in…

Q: Compare the three forms of pemphigus.

A: Damage of the skin, the insides of the mouth, nostrils, esophagus, eyes, and genitals are symptoms…

Q: Which of the following statements is true about certainty of paternity? Question 12 options:…

A: The degree in which a putative parent can be positive whether he, she, or it is the parent of a…

Q: Draw and label x.s. of Amphioxus, amphibian, avian and mammalian clavage and blastula stages. Label…

A: The stage of early animal embryonic development known as blastulation is when the blastula is…

Q: TRUE OR FALSE: • Digestive secretions from the ● small intestine complete the digestion of…

A: Introduction As food is digested in the small intestine and dissolved in juice from the pancreas,…

Q: C > introduction to Science-B10111-N881: General Biology! 3. What would your experimental approach…

A: Hypothesis in research field is the statement of the result expected or prediction that will be…

Q: Elephant seals are a sexually dimorphic species of marine mammal that lives off the coast of…

A: Narrow-sense heritability is defined as the fraction of phenotypic variance that can be attributed…

Q: Water is split during the Calvin Cycle of photosynthesis O True False

A: The statement is true

Q: M09.  Answer correctly. Else

A: We know that Gametogenesis is the process by which gametes are produced. In humans, sperm is the…

Q: Pls help if u can, sorry for the trouble Relate these terms in a single sentence: cells, organs,…

A: Introduction The fundamental and basic units of all living things are cells. There are many billions…

Q: In CAM plants, the Calvin Cycle occurs during the day. True False

A: CAM - Crassulacean Acid Metabolism is a mechanism of photosynthesis involving double fixation of CO2…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: draw the products of meiosis (gametes) produced by Alignment C.

A: The indirect process of cell division in which the chromosomes of parent cells divide once but…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.