BamHI >

Q: The nervous tissue that consists of myelinated axons transmitting information throughout the central...

A: The white matter refers to the sections of the brain and spinal cord that communicate between the va...

Q: Trace the flow of hormanes in the adaptive thermoregulation response involving brown adipose tissue....

A:   In thermogenesis the production of heat energy in brown any post issue is a component of the homeo...

Q: ans develop from the neural tube and neural crest

A:

Q: What is the climax stage of an ecological succession?

A: Introduction In this question we will discuss about the climax stage of an ecological succession.  

Q: Human somatic cells have 46 chromosomes. Are the cells different in any way from the parent cell and...

A:

Q: t your physician sunpects you have symptoms of a genetic disease, he can colect cells for genetic te...

A: INTRODUCTION Answer of question 4 is given below.

Q: In what ways are mitosis and meiosis different?

A: The fundamental and active biological process by which a parent cell, after replication of it's comp...

Q: Dopamine is an inhibitory neurotransmitter released into neuromuscular synapses Patients with Parkin...

A: Parkinson disease is a disease of central nervous system. Currently there is no cure of disease.

Q: how the theory of evolution affects ours view of origin,developtment and spread of new diseases such...

A: Theory of natural selection stated that the survival of the fittest is the ultimate driving force fo...

Q: How do we know that members of the human lineage used to have an opposable toe on their foot?

A: There was a fossil discovered some years back in Ethiopia which led us to draw a conclusion that hum...

Q: Which of the following statements is most likely behaviorally when applied to a male primate with a ...

A: Introduction: When male and female individuals are distinguished externally, the phenomenon is calle...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: INTRODUCTION Leishmania They are flagellated protozoa causing kala azar. The developmental stages of...

Q: Discuss the traits in the body (not head/skull) that define Primates and set them apart from other m...

A:

Q: 1. Differentiate Precipitation from Agglutination reactions based on:      a. Time duration of the ...

A: Agglutination is the procedure of clumping antigens with their respective antibodies. Agglutination ...

Q: Which of the following statements indicate the function of growth hormone? It controls and regulates...

A: Hormones are chemical substances that act like chemical messanger molecules in body . They are synth...

Q: Given the following information about the inheritance of characteristics in pea plants, answer the q...

A: Note - we are supposed to answer one question with three subparts according to our guideline.  Pleas...

Q: WHAT IS SNAIL IS CERCARIA OR METECERCARIA

A: Snail is CERCARIA What is CERCARIA?     Cercariae are the final intra molluscan larval stages that e...

Q: What are the characteristics of small intestine epithelial cells and kidney epithelial cells observe...

A: Intestinal epithelial cells are the surface of intestinal epithelium, where they play important role...

Q: Jack, a new MLT at Cape Fear Hospital was given the following information from a patient's urine sam...

A: Introduction: In microbiology, a CFU stands for colony-forming units. It is a unit that we use for e...

Q: 2. Draw a Punnett square of a cross between a homozygous dominant individual and a heterozygous indi...

A: Answer 1: -  Parent individuals: - BB (homozygous dominant), Bb(heterozygous dominant) Cross: -  ...

Q: Which of the following statements accurately describes the pattern of recruitment in a muscle when p...

A: The contraction of muscle is responsible for the development of muscle movement. The generation of s...

Q: You are performing a Gram stain on Gram-negative bacteria, and you stop after the addition of the al...

A: Gram negative bacteria: these bacteria are enclosed in hard capsule and don't retain the crystal vio...

Q: 12. Assume that spherical particles with diameter=100 µm and density=1.1 g/cm³ have sedimentation ve...

A: 13. Isopycnic centrifugation is better to separate RNA from protein .

Q: MLS supervisor is writing an Standard Operating Procedure (SOP) for running a PC test for Hepatitis ...

A: 1. Ongoing quantitative PCR for HBV DNA DNA was extricated from 200 μL of serum utilizing the QIAamp...

Q: a. After conducting the Gram staining procedures and you observed that all cells are stained with to...

A: The microorganisms that can be found in several areas of the habitat and come under the category of ...

Q: What were the major developments that facilitated the current level of acceptance of a possible link...

A: Violence: it is an extreme type of aggression. 

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: in only one cell, label the nucleus, cytoplasm, and cell membrane for these two figures. Describe th...

A: 1. It is simple cuboidal epithelial cell , it is located at lines kidney tubules.  Nucleus is presen...

Q: Identify the steps involved in designing an experiment.

A: Experiments are conducted to test a particular hypothesis. Results then give a measure of how true o...

Q: 1. After exposure to a mutagen an A-T base pairing becomes T-A in the daughter cell. This is an exam...

A: Please note, keeping with the site regulations and in order to provide accurate and detailed answers...

Q: Which of the following is a type of gene transfer that is NOT species-specific? O conjugation O tran...

A: Answer 5:- Transduction is a process in which the virus transfers genetic material to the cell. Here...

Q: Why is leguminous crop rotation used in agriculture?

A:

Q: Enumerate and describe the types of cells according to their capability to regenerate. Give examples...

A: Regeneration of cells is the natural process of replacement or restoration of damaged cells. Based o...

Q: Given below is the diagram of the human ear. Study the same and answer the questions that follow: Ea...

A: (i)The ear ossicles are the part labelled 'A.' Malleus, incus, and stapes are the three bones that m...

Q: The placenta is your unborn baby's life support system and plays a key role in its development. Ans...

A: The placenta is a vital organ that plays a crucial role in fetal development. Without it, the fetus ...

Q: You are spending a summer in Austria following up on some of Mendel's work. You are studying the inh...

A: Let the allele causing colour be R/r Hence, genotypes of Red colour (dominant):- RR, Rr Genotypes of...

Q: Mycobacteria tuberculosis and Rickettsia

A: Mycobacterium tuberculosis is a pathogenic that bacteria from the family Mycobacteriaceae and the ca...

Q: 1. What is an exocytosis? 2. What is an endocytosis? 3. Explain the types of endocytosis and give ex...

A: Hello, thank you for your questions. But following the guidelines we are providing the answers for f...

Q: comprise the membrane. If you isolated a single transmembrane helix from a protein from this strain,...

A: Since the newly identified bacteria has normal nucleic acids and proteins - the amino acids in the p...

Q: Describe how hair cells work in general, and in the fish lateral line system.

A: Lateral line system  It is a type of sensory system found in fishes and aquatic amphibians. This sys...

Q: True or False. The binding affinity between a peptide agonist and its specific G protein coupled rec...

A: Introduction:- Intermolecular interactions such as ionic bonds, hydrogen bonds, and Van der Waals fo...

Q: Malaika is a 30 year old African lady with a history of Schizophrenia. She is currently taking Olanz...

A: Malaika is currently taking Olanzapine 20 mg, a drug to treat Schizophrenia. Olanzapine : Olanzapine...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Mosquito repellent: the chemicals that repels the mosquito away. 

Q: Which of the following statements does NOT describe Darwin's theory of natural selection  A. Member...

A: * Natural selection is the mechanism in populations of living organisms adapt and survive best. *Spe...

Q: expalin how theory of evolution affects our view of the origin, developtment and spread of new disea...

A: The theory of evolution is based on the idea that all species are linked and evolve through time. Th...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: Introduction :  In electron transport chain 4 protein complex create electrochemical gradient to pro...

Q: Pt the events of action potertl generstion in the onder tut they occur from fst ) to last (S wved ot...

A: * Action potential is a when s cell was activated by stimulus  reversal in electrical potential acro...

Q: 1. Read the paragraphs below. For each paragraph, write the letter of the diagram from the diagram s...

A:

Q: As global average temperature increases, which of the following regions is expected to experience th...

A: Global warming is a phenomenon in which the earth's global temperature is increased due to the emiss...