B. If you had extracted your own DNA instead of extracting the onion/strawberry/banana DNA, do you expect that your own extracted DNA would look similar to the extracted onion, strawberry, or banana DNA?

B. If you had extracted your own DNA instead of extracting the onion/strawberry/banana DNA, do you expect that your own extracted DNA would look similar to the extracted onion, strawberry, or banana DNA?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Related questions

Q: Describe how it is that when a short tandem repeat (STR) genomic region is PCR-amplified you can get…

A: * PCR is known as Polymerase chain reaction , a method which is used to make billions of copies of…

Q: Explain Direct Isolation of a Specific Segment of Genomic DNA.

A: The genomic DNA (deoxyribonucleic acid) is the chromosomal DNA that is present in the nucleus of a…

Q: Is the DNA isolated from Cheek Cells using Saline solution, Detergent, and Ice-cold alcohol pure or…

A: DNA is a genetic material present in every cell.

Q: ocedure to extract DNA through banana?

A: A nucleic acid called DNA is arranged into chromosomes. It has genetic data in it. Polynucleotide…

Q: List and describe the 3 types of fetal testing.

A: we are supposed to answer only first question in case of multiple question posted. Please repost the…

Q: What information do learn from the results of the DNA extraction?

A: 1.Breaking cells open to release DNA. 2. Separating DNA from proteins and other cellular debris.…

Q: Saenger’s DNA sequencing procedure. Include the method and the main reagents used

A: Its a DNA sequencing method

Q: Describe the benefits of using whole genome sequencing for diagnosis.

A: The whole genome shotgun method involves cloning, followed by accurate computer sequencing of the…

Q: Chronic Myelogenous Leukemia (CML) -Briefly describe the disease and provide the most common…

A: Leukemia It is the group of malignant disorder. It affects the blood and blood forming tissues of…

Q: DNA polymerases make errors in matching as DNA is synthesized. These errors can be detected and…

A: DNA replication is the process by which two exact copies of DNA are made from an original DNA…

Q: Define about stoneage genomics ?

A: The discovery of ancient genomics such as stoneage genomics has revolutionized our understanding of…

Q: Explain the Technical Issues Surrounding DNA Profiling ?

A: These concerns include fundamental human error and human discrimination, connecting innocent people…

Q: suggest reasons for why DNA mutations are not all phenotypic.

A: Mutation is a change in nucleotide sequence of DNA which can occur either due to mistakes during DNA…

Q: Explain The replica plating technique?

A: Replica plating is used in the microbiological experiment. It helps in the testing of various…

Q: Explain about Molecular Alterations to the Genome ?

A: a genome is all genetic material of a creature. It comprises of DNA (or RNA in RNA virus). The…

Q: Describe the occurrence of repetitive sequences, and explain how they are used in DNA…

A: A tandem repeat are repetitive DNA sequences of two or more base pairs that are repeated in such a…

Q: Describe the various steps involved in the technique of DNA fingerprinting?

A: The first step involves the enzymatic digestion of dna using suitable restriction…

Q: State and describe the benefits of using whole-genome sequencing for diagnosis.

A: The whole genome shotgun method involves cloning, followed by accurate computer sequencing of the…

Q: Examination of the nucleotide sequences found at the ends of chromosomes , indicate whether it…

A: The End of the Chromosomes is known as the telomeres. Telomeres are the repetitive sequences that…

Q: Explain the process that damages DNA has the potentialto be carcinogenic ?

A: The cells have developed various mechanisms for DNA (deoxyribonucleic acid) damage repair that is…

Q: . Illustrate the basic steps in DNA extraction

A: The genetic material that is densely packed inside the nucleus and chromosomes is known as DNA. The…

Q: Define the process of Interpreting DNA Profiles ?

A: DNA profiling is also called DNA fingerprinting or DNA typing. It is a technique used to distinguish…

Q: Explain the use of DNA profiling ?

A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Q: What is DNA abbreviation of?

A: DNA is the molecule that carries the genetic instructions for building, organizing and running all…

Q: Why is DNA microarray an important tool and explain How is DNA microarray used in detecting cancer?

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Can DNA be isolated from beef? Discuss the process briefly

A: The purification of DNA from the collected sample of DNA with the help of the various methods and…

Q: What impact has the Human Genome Project had on medicine and health? On forensic DNA testing?

A: The human genome project was a 13-year project which was initiated by the National Institute of…

Q: Is it possible to obtain DNA in cloverleaf configuration? Explain

A: Cloverleaf Model: The cloverleaf model of tRNA is a representation of the molecule's structural…

Q: Explain about Genomic techniques ?

A: Introduction Genome is basically consisting of DNA which is composed of deoxyribose nucleotides.…

Q: Define Satellite DNA ?

A: DNA or deoxyribonucleic acid is a nucleic acid containing deoxyribose sugar. This acts as the…

Q: Define how chromosomal DNA is extracted from cells or tissues ?

Q: B. Write a paragraph on the importance of DNA availability and the impact it has on Protein…

A: DNA is deoxyribonucleic acid (genetic material) found in all living cells. In prokaryotes, it is…

Q: After a piece of DNA is sequenced, what type of analyses can be performed?

A: After the sequence of the DNA have been found many analysis are performed on the DNA.

Q: What implication does eating DNA have on the commercial properties of DNA in your hair conditioner,…

A: As Humans have continuously consumed deoxyribonucleic acid from plants and animals.

Q: A. What is random mutagenesis? B. How many people a year die due to insecticide misuse and exposure?

A: Selective breeding practises having existed for crops ever since man started cultivation. So there…

Q: Which are the polymorphic regions in DNA and how are they used for DNA fingerprinting?

A: The genes are the primary unit of life. The nucleotide sequence of the genes are responsible for…

Q: Give the information about DNA mutation types from SNP to large structural variation.

A: Hugo de Vries was the first one to coin the term “mutation.” It is studied under the domain of…

Q: Explain the possible repercussions to an organism, when a mutation occurs in the genome?

A: Mutation The change or variation occurs in the sequence of DNA is known as mutation. In mutation…

Q: What is the results of extracting the DNA of a strawberry?

A: Ripe strawberries are an excellent source for extracting DNA because they are easy to pulverize and…

Q: Explain the manipulation of newly created recombinant DNAmolecules ?

A: Introduction Gene cloning is the technique to produce the exact copies of the desired gene by…

Q: Specify the role of different chemicals employed in DNA extraction

A: DNA (Deoxyribonucleic acid) extraction is the isolation of the DNA from a cell using different…

Q: What is the function of the “junk DNA” in human genome? proper explanation and diagram

A: DNA (Deoxyribonucleic Acid) is the genomic material found in the cells of living organisms that help…

Q: What information do learn from the results of the DNA extraction?

A: Hi! Since you posted more than one question, we will be answering one for you. If you want the other…

Q: explain Mutations: Primary Tools of Genetic Analysis

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Describe the process of DNA-mediated transformation, including the role of competent cells.

A: Gene transfer is the method of inserting genetic material (DNA or a gene of interest) into cells…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

what is the difference between human DNA and strawberry DNA?

B. If you had extracted your own
DNA instead of extracting the
onion/strawberry/banana DNA,
do you expect that your own
extracted DNA would look similar
to the extracted onion,
strawberry, or banana DNA?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

. Explain how gel electrophoresis is used to separate DNA fragments of different lengths.
(b) Use a drawing to illustrate the principle of DNA gel electrophoresis. +
a. What type of nucleic acid and from what species would the scientist use to begin construction of her genomic DNA library? b. From what tissue would she isolate this nucleic acid? c. What type of reagent would the scientist use to cut the genome into appropriately sized fragments? d. What size nucleic acid fragments would one aim to prepare for the library construction so as to to avoid having to screen an overwhelming number of clones? e. Into what vector would the scientist ligate her genomic DNA fragments? f. What organism would the scientist use to propagate the clones of her genomic DNA library? g. From the information given in the problem determine what probe could be used to screen the scientist's library to find her clone of interest ?
Describe the purpose and process of DNA finger printing.
Page < Lab Procedure: The forensic specialist sends you the DNA from the crime scene (CS), and DNA from four different suspects (suspects A, B, C, D). You perform a PCR with each DNA sample. Using primers specific to the DNA sequences on either side of the STR, you amplify billions of copies of each of the two original TH01 alleles in each DNA sample (CS, A, B, C, and D). Then you run an agarose gel (DNA gel electrophoresis), which separates the DNA fragments by size. You obtained the following results (picture of DNA gel): CS A B C D Ladder
a. Explain whether or not DNA polymerase from a mesophilic bacterium could be used successfully in a PCR reaction. b. If starting with a single double-stranded DNA molecule, how many copies of the DNA would be synthesized after 25 PCR cycles?
Examine the DNA model, what are the features that contribute to the stability and the ability of the DNA to replicate faithfully? Identify the specific molecule represented by the following colored plastic chips. Color Molecule Represented BrownWhiteOrangeBlueGreenRedPinkYellow
A.How could endonucleases interfere with the transformation procedure? B. Does supercoiled or nicked plasmid get transformed more efficiently? Why?
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
A. Illustrate. Consider the given pair of homologous DNA molecules. T I' t t' Y Y' y y' L L' I l' G G' g g' Suppose the single strand breaks in the figure initiated an exchange of segments, and branch migration proceeded up to the L'-G' region. Following the color-coding and genotypes of the given DNA molecules, 1. Draw the resulting DNA molecule after branch migration. Do not forget to show the Holliday junction.
a. How do scientists apply the concept of linkage disequilibrium to identify disease alleles? b. Which specific phrase is used when such markers are identified by restriction endonucleases and a particular set of DNA fragments is generated?
(c) Draw roughly the comparative electrophoretic mobilities of close circular DNA, opencircular DNA and super coiled DNA, all having the same molecular weight.