Axons in the optic nerve from the right eye O all go to the left occipital lobe O all go to the thalamus O go mostly to the thalamus but some go to superior colliculus Noe of the choices

Q: 800 Identify the cell IID

A: white blood cell are colourless nucleated red blood cells which lack hemoglobin and which…

Q: (c) Н НО н CH ОН CH₂OH Н ОН + Cu2t (aq)

A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are single…

Q: CN12 Hypoglossal

A: The twelve pairs of nerves that arise from the brain and function to connect the brain with several…

Q: What is blubber

A: The group of multicellular and heterotrophic organisms belonging to the kingdom Animalia is called…

Q: what is frank blood

A: Frank blood is found in various diseases such as colorectal cancer, vomiting, fissures, ulcers,…

Q: who is Lilian Wald?

A: Sometimes, it seems as though one person today can only make a small difference in the world.…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: The heterozygous phenotype is a blend the two homozygous of phenotypes. This creates a fedomio…

A: Answer:  Homozygous and Hetrozygous are the two types of alleles arrangement. In homozygous, the two…

Q: A hepatocyte is infected with the Hepatitis C virus. It will use: O Exogenous antigen processing and…

A: The Major Histocompatibility Complex (MHC) is a gene family found in all vertebrates that codes for…

Q: C A E В Н I

A: Cell is the basic structural and functional unit of life. An animal cell contains a cell membrane,…

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: who is percy lavon julian?

A: Percy Lavon Julian was an African-American chemist and pioneering scientist who made numerous…

Q: Chapter 4 question

A: The skin is the largest organ of the body that serves as a fine boundary between the outer and inner…

Q: How did you get that?

A: The probability is zero.

Q: What would happen if a mutation prevented development of the syncytiotrophoblast cell layer?

A: Introduction :- The syncytiotrophoblast (ST) is the placental barrier between maternal and foetal…

Q: FAILURE TO THRIVE

A: Failure to thrive is a descriptive term and is not actually a diagnostic term. This term is used…

Q: What is the neuromuscularsynapse?

A: The neuromuscular junction is a site where, the axons and the muscle fibers communicate with each…

Q: Identify the highlighted cell type.

A: Cells are the smallest and basic unit of life that is very important for all life processes…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: Where did you answer the last 2 questions?

A: 5'UTR stands for untranslated region at the 5' end of the DNA sequence. 3' UTR stands for…

Q: 7

A: The urinary system is responsible for the production, storage, and excretion of urine. Urine is…

Q: Appendicular S

A: Bone is a metabolically active connective tissue that aids in mobility, protects essential organs,…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: How is cystic fibrosis inherited

A: Cystic fibrosis is a disease that affects the lungs and organs of the digestive tract due to…

Q: Thoughts on vaccinations

A: The use of vaccinations or vaccines is essential for suppressing the spread of infectious illnesses.…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: ycle is -

A: Eukaryotic cells divide either by two ways mitosis or meiosis. Mitosis occurs in somatic cells…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: Loss of heterozygosity of tumor suppressor gene_______________

A: Loss of heterozygosity -It is the loss of one parent's contribution to cell and can be caused by…

Q: 7nm= _ um= _ mm

A: 1 nano meter is equal to 0.001 or 1/1000 micrometer 1 micrometer is equal to 0.001 or 1/1000 milli…

Q: What is Menke's disease? Give very brief explanation.

A: Copper is required for functioning of many enzymes in the body like amine oxidase, ferroxidase,…

Q: Can you do the first part

A: