Q: Explain the several reasons on additional levels of complexity are both possible and necessary for…
A: Gene expression is a complex process that is mediated by several processes. There are around 20,000…
Q: What are the major factors in the various mutants of the spike protein
A: Novel coronavirus (2019-nCoV, later named SARS-CoV-2 or severe acute respiratory syndrome…
Q: describe what is CNVCopy number variant?
A: The human genome consists of 6 billion chemical bases or nucleotides of DNA packed into two sets of…
Q: What are the requirements for an expression vector?
A: The expression vector helps to yield the product of the cloned gene.
Q: What does the apparent need for dosage compensation mechanismssuggest about the expression of…
A: Dosage compensation is the epigenetic mechanism in which the expression of genes is equalized in…
Q: What is the basis for spectrum karyotyping?
A: Answer: Introduction: A karyotype is the method of taking picture of chromosomes and to study its…
Q: What is The Luria-Delbrück fluctuation experiment?
A: Mutations are defined as any change in the nucleotide sequence that also alters the phenotype of the…
Q: explain the symptoms of Robertsonian translocation?
A: Robertsonian translocation is a type of translocational chromosomal aberration in which acrocentric…
Q: what is dosage compensation.?
A: Sex of an organism in various species depends on the type and number of sex chromosomes. In species…
Q: Briefly explain the steps to induce the expression of gene of interest using IPTG
A: IPTG, also known as isopropyl -D-1-thiogalactopyranoside, is a biochemical agent that mimics…
Q: What are the possible genotypes of the PTC locus?
A: * genotype means collection of genes that refers to two alleles of a particular gene and genotype…
Q: How should the INS gene is prepetuaded through generation?
A: The INS gene codes for the protein insulin. This protein is a peptide hormone that plays an…
Q: why did the frequency of the apparent separation vary depending on thegenes being studied?
A: The segments of DNA are the gene. These consist of code that is involved in the synthesis of a…
Q: Identify the mechanisms of transcriptional,posttranscriptional, and translational control of…
A: Transcription is syntheisis of m-Rna from the Dna and it occurs in cytoplasm of the cell and require…
Q: Robertsonian translocation is balanced or unbalanced?
A: "Robertsonian translocation" is a type of translocational chromosomal aberration in which…
Q: Explain the Choice of vectors?
A: Cloning Vectors are small pieces of DNA taken from a plasmid, virus, bacteria, and cell of any…
Q: Why are maternal effect genes so difficult to identify via mutant analysis?
A: Introduction :- In an offspring , the genes are contributed by both of the parents but the mother…
Q: How is such a linear activation of Hox genes carried out on the cellular level?
A: The Hox gene determines segment identity—whether a segment of the embryo will become a component of…
Q: What is the difference between reciprocal and nonreciprocal translocation?
A: A type of chromosomal rearrangement like inter-chromosomal or intra-chromosomal is known as…
Q: Describe the two assumptions that underlie the identification ofdisease-causing alleles via…
A: Gene is a functional unit of heredity. A gene is a sequence of nucleotides in genome that codes for…
Q: How can you tell if an individual is heterozygous for the D1S80 marker?
A: The term heterozygous variant belongs to a subdivision of biology, genetics. Genetics is the study…
Q: Under what circumstances could nonhomologous endjoining be said to be error prone?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Explain selectable and non selectable markers for the detection of transformants?
A: Marker is a gene used to conform whether a nucleic acid sequence has successfully been inserted into…
Q: Is the organism causing COVID-19 living or non-living? why? Describe the molecular and cellular…
A: The viruses, bacteria and parasites are responsible for causing different diseases which in human…
Q: Explain the expression vectors ?
A: Introduction A vector is a DNA molecule that is used in molecular cloning to intentionally transport…
Q: What is the major difference between generalized transductionand transformation?
A: TRANSDUCTION:- Is the process by which DNA is transferred from one bacterium to another by a virus…
Q: explain Mapping genes by cotransductionfrequencies.
A: Transduction is the process of genetic recombination when a virus acts as a vector for delivering…
Q: Compare and contrast the molecular and phenotypic features of Prader-Willi and Angelman syndromes.
A: Prader villi and angle man syndrome are imprinting disorders. Both are related to abnormalities in…
Q: Contigs are often made using BAC or cosmid vectors. What are theadvantages and disadvantages of…
A: A contig refers to a set of overlapping segments of DNA (deoxyribonucleic acid) together forming a…
Q: In a cotransduction experiment using P1, the transfer of one geneis selected for and the presence of…
A: Genetics is a branch of biology that deals with genes, heredity, and variation. Heredity purely…
Q: What are selectable marker genes ? Explain the role of selectable marker gene ?
A: Seletable marker Genes are present in the plasmid and they are help in selection if…
Q: In plant and animal genomic transmission level, what particular phenetic variants are likely…
A: Phenetic refers to classification of organisms based upon the similarities present in them for…
Q: which specifies an inactive ASIP protein, and for the Kb allele of gene K, whose product is a…
A: ASIP (Agouti signaling protein) is an antagonist of MC1R (Melanocortin 1 receptor). MC1R is a G…
Q: Give at least three (3) dosage forms in which liberation is altered?
A: The process by which medicine enters the body and liberates the active substance that has been…
Q: If you were to engineer some non-adhesive cells to express E-cadherin at either high levels or low…
A: Introduction: E- Cadherin is a type of cell adhesion molecule (CAM) that are important in the…
Q: How did the discovery of three categories of petite mutations in yeast lead researchers to postulate…
A: Extranuclear inheritance is defined as the transmission of genes that happen outside the nucleus. It…
Q: Explain the Analysis of Neurospora Mutants by Beadle and Tatum ?
A: Neurospora crassa or red mould is a fungi. It can be grown easily in culture medium supplanted with…
Q: Describe and compare the structural features of Ig genesuperfamily constant and variable domains.
A: Immunology is the branch of medical science that deals with the study of the immune system and…
Q: Explain the mechanisms of disease development that result from or cause geneexpression changes in…
A: Mutations Changes to an organism's DNA sequence . Can be the result of viral infection, exposure…
Q: Is this data represented as a "dot plot or histogram? What does Forward Scatter (FSC) represent?…
A: Flow cytometry is the technique which is used to detect the physical and chemical characteristics of…
Q: What determines the likelihood that two genes will be cotransduced?
A: To determine the likelihood that two genes will be cotransduced
Q: can BRCA1 null mutant transcribe any genes
A: The genes BRCA1 and BRCA2 (BReast CAncer genes 1 and 2, respectively) generate proteins that help in…
Q: What is Proteomic Phenotype and its connection to COVID-19?
A: The emergence of novel coronavirus disease 2019 (COVID-19), caused by the SARS-CoV-2 coronavirus,…
Q: Explain dosage compensation?
A: It is a mechanism that helps in maintaining the number of X chromosomes by inactivating 1 X…
Q: Compare and contrast the molecular mechanisms leading to FX syndrome and to FSHMD.
A: Introduction :- A gene originally known as FMR1 gene by scientists and responsible for FXS is…
Q: What is the visibility of proteomic phenotype in COVID-19 patients?
A: The protein is defined because the set of proteins that an organism will manufacture. By…
Among different species, describe three distinct mechanisms for
accomplishing dosage compensation.
Step by step
Solved in 2 steps
- It has been found that blood types (ABO) affect the COVID-19 infection rate and the disease severity. Blood type A individuals are more likely to be infected and more likely to suffer from severe disease. Blood type O individuals seem to be less affected. Outline possible reasons for this. Note: So far, no studies have been published to conclusively answer this question, so there are no "wrong" answers here. The point is to come up with some ideas/hypotheses based on your knowledge about the molecular basis of blood types and what the consequences might be in relation to viral infections.What are the possible genotypes of the PTC locus?Include a description as to why disrupting the expression of each gene leads to the phenotype observed of C.Elegans bli-1, dpy-10, rol-6, unc-22, egl-1 and pos-1
- Describe the Egly precueing experiment. What is the same-object advantage,and how was it demonstrated by Egly’s experiment?What is a STEMI? What is the underlying mechanism of this?See the hypothetical pathway answer the following questions. A) If an individual is homozygous for a null mutation in the gene that codes for Enz1, what would the result be? B) What would happen if an individual is heterozygous for a mutation that abolishes the activity of Enz2? C) What could happen to the offspring of the individuals described above (in a and b)? Assume that they only have the mutations described.
- What is dosage compensation? Give its importance. explain pleaseThree haploid fungal mutants that require compound W for growth were isolated. Each mutant contains a recessive allele in a single gene. Three compounds (A, B and C) in the biosynthetic pathway to W are known, but their order in the pathway is unknown. Each compound is tested for its ability to support the growth of each of the three mutants. Phenotypes of all of the three mutants are shown in the following table (“+" indicates growth, "-" indicates no growth). A C W Mutant 1 Mutant 2 Mutant 3 What would be the phenotype of a haploid mutant that contains both mutant alleles in mutant 2 and 3? Phenotype refers to growth or absence of growth on compounds A, B, C and WN. O Like mutant 1 O Like mutant 2 Like mutant 3 O Like wild typeUsing the information provided below, which of the individuals A and B have: i) Genotypic change ii) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q F P WA V Q T W Y D S L GAI .. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the mRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter G UAU UCU c Phe UCc UGU UUC U UUA UAC JTyr UGCCYS Ser UCA UCG UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu G. CUU CCU CCC Pro CAU CAC Hi. CAA CAGJ CGU CGC CUC CUA Leu CCA Arg CGA Gin CUG CCG CGG AUU ACU ACC ACA AUG Met ACG LAsn AGUser AAC AUC…
- please explain punnet square. How do I know which one is dominant in a species or human?Epstein-Barr virus is associated with Burkitt’s lymphoma. The rate of EBV and c-myc gene translocation seems related, as both are highest in Equatorial Africa, lowest in North America and intermediate in South America. Explain what is c-myc translocation and why it results in overexpression of c-myc. What is the role of EBV in causing c-myc gene overexpression?The phenotype of a heterozygous mouse (Aa) is agouti. The agouti banding pattern is due to altered expression of the agouti gene. Which of the following statement is false? a) Expression of the agouti gene inhibits the production of eumelanin. b) Evidence suggests that the agouti gene is only expressed in tissues associated with fur production. c) Epigenetic markers silence the agouti gene resulting in dark pigmentation at the tip and root of the hair. d) All of the above