а. СН —О—с— (СH-)12CH3 b. CH2- -(CH2)12CH3 CH-O-C-(CH2)12CH3 CH-O-C-(CH2),CH=CH(CH2)5CH3 ČH2-0-C-(CH,)12CH3 ČH,-0-C-(CH2),CH=CH(CH,)7CH3
Q: Which aspect does NOT distinguish bacterial SMC proteins from eukaryotic SMC proteins
A: SMC proteins are the structural maintenance proteins of chromosome. Mostly present in both…
Q: Identify the following by describing their functions: EF-G, EF-Tu, EF-Ts, EF-P, and peptidyl…
A: Elongation factors are a set of proteins that function at the ribosome, during protein synthesis,…
Q: Why is O+ compatible with O+, AB+, A+, B+?
A: Introduction : Landsteiner studied the properties of blood cells and the proteins on the surface of…
Q: C6H8 + O2 ------à CO2 + H2O How many grams of C6H8 are needed to…
A: The mole concept is the part of chemistry that deals with the number of moles of a reactant that…
Q: Q:-What is a xaxim?
A: Introduction In this question we have to discuss about the xaxim.
Q: Why is it important for mitosis to produce genetically identical daughter cells?
A: The cell division is responsible for the generation of daughter cells from the mother cell. Usually…
Q: What is β-globin gene ?
A: The process by which the characters are carried forward from the preceding generation to the…
Q: Which isomer- (R)-arginine or (S)-arginine is D-arginine? O (R)-arginine O (S)-arginine Submit…
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Enantiomers…
Q: Explain about the Prader–Willi syndrome ?
A: A genetic disorder can be defined as a health problem which is caused by one or more abnormalities…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: What are Chargaff’s rules?
A: DNA is an organic molecule that includes genetic data as well as directions for protein creation. It…
Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…
A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…
Q: What are the distinct feature in vancomycin? 2. What are the distinct feature in teicoplanin?
A: Vancomycin: Vancomycin was discovered in the year 1950 and it was approved by the Federal Drug and…
Q: How are aposematism and mimicry related? Make sure to define both terms in your answer
A: Both aposematism and mimicry are behaviors of animals. Behavioral ecology is a branch of study of…
Q: 8. What is agglutination?
A: Agglutination comes from the latin agglutinare. Agglutination is formed in the blood. Agglutination…
Q: What is E- and N-cadherins
A: N- cadherin also known as Cadherin-2 is a protein which belongs to the superfamily of calcium…
Q: 5. amino acids classified to biological and -- -
A: Amino acids are the monomers that build up the proteins. They contain two functional groups namely…
Q: 1. Discuss the following а. Differences between:
A: Capillaria philippinensis The C. philippinensis can cause a serious intestinal infection. The…
Q: What are Peyer’s patches?
A: The gastrointestinal tract also called the alimentary canal serves the passage of food from mouth to…
Q: please answer all give the significance/role/effect of the reagent/condition in the isolation or…
A: Electrophoresis It is defined as a technique through which biomolecules such as DNA, RNA, or protein…
Q: Gample Albumin (1) Initial ColorHypothesis (Protein +/-)Final Color Protein Present? Light yellow…
A: Proteins are the building blocks of the body. They are a polymer made by monomeric unit amino acids.…
Q: What are hexoses?
A: Introduction: The most basic type of carbohydrates are monosaccharides. They are categorised based…
Q: ivision into 2 identical cells?
A: Cell division is a very important process that is required for the growth and development of an…
Q: What determines human blood groups? Group of answer choices None of these answers. protein…
A: Introduction :- In case of types of human blood groups , more than 24 types of blood group are…
Q: - Trp G CCU Pro CAU - His CGU - Arg U CUU Leu CUC Leu CCC Pro CAC- His CGC - Arg C CUA- Leu CCA Pro…
A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…
Q: 80 um What feature are the brackets wrapping around? What cells are found inside the bracketed…
A: Brackets are wrapping around cells of the hyaline cartilage. These are the cells that constitute the…
Q: explain what is macrotaxonomy?
A: A P Candolle proposed the term "taxonomy" in 1813 for the first time.
Q: K ellum Some ole J- F G H cMicrotu}
A: The above diagram depicts a generalized animal cell. An animal cell is eukaryotic in nature.
Q: Discussian:- what canbediscavered firaka anendescap42
A: The medical tests are performed using two procedures that includes invasive and non-invasive…
Q: 3 How is a plaque similar t
A: In the biotic world, there are numerous organisms. The world's ecosystems are the result of the…
Q: What are the hair-like appendages on the cell on the left?
A: A cell can be outlined as the cytoplasmic mass that is surrounded by a lipid bilayer known as a…
Q: 20. Describe the structure of the glycocalyx and explain its various functions.
A: The discovery of the endothelium glycocalyx has allowed the traditional Starling principle to be…
Q: What is other name of Melosis-I ?
A: Cell division is the process by which a parent cell divides into two or more daughter cells. Cell…
Q: What is palindrome ?
A: Palindrome is sequence of of word,pharse and other sequence of charecter which is same when we read…
Q: In people, what is a common cause of thymine dimer formation and in what cell type(s) would it be…
A: Pyrimidine dimers are molecular lesions formed from thymine or cytosine bases in DNA by…
Q: Explain the hemizygous for the gene mutation ?
A: hemizygous for the gene mutation is :
Q: Fill in the blank: Polymorphonuclear leukocyte is another name for a _______________________ with a…
A: Blood is a body fluid in humans and other animals. It delivers necessary substances such as oxygen…
Q: Write a note on Enalaprilat? Write at your own words
A: A substance that is used to prevent or cure a disease is defined by a term called a drug. Drugs can…
Q: In cystic fibrosis protein abnormality occurs, that protein is found in?
A: Dear student answer of your question is given below: It is located on the long arm of Chromosome 7.…
Q: 7.Chromosomes are found in the 8.Genes are pieces of DNA located on the of a cell. ----- .--
A: 7. Chromosomes are found in the nucleus of a cell. 8. Genes are piece of DNA located on the…
Q: What specific proteins make up the cellular cytoskeleton? What protein would you use to look at…
A: Cytoskeleton is a dynamic and 3 dimensional structure, that helps the cells to maintain thier shape…
Q: What is Usher's Syndrome?
A: Usher's Syndrome is genetic condition. It was named for Charles Usher, a eye doctor who identified…
Q: Who gave the statement “Omnis cellular cellula”?
A: Science is a systematic enterprise that builds and organizes knowledge in the form of testable…
Q: 7. Draw the protein: SRDR
A: The code SRDR is the one-letter representation of amino acid sequences. Each letter of the code…
Q: why is nuclei stained purple but the cytoplasmic components are pink in eosin?
A: Answer
Q: 1. What is the difference between flocculation and agglutination?
A: We know that Glomerulonephritis, vasculitis, and a number of other systemic lupus erythematosus…
Q: Are ray initials longer or shorter than fusiform initials? Can they undergo both periclinal and…
A: The main growth tissue in plant’s stem and roots is referred to as vascular cambium. It is a type of…
Q: Give the letters for the side groups that are likely to interact strongly with blood plasm NH NH,…
A: Proteins are polypeptide chains of amino acids. Amino acids can be both polar and non-polar.…
What is the composition of the soap formed by basic hydrolysis of each triacylglycerol?
Step by step
Solved in 3 steps with 3 images
- HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T GA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-A TG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG- AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: USE "-" TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE TO SEPARATE AMINO ACIDS, NO SPACES): c. What are the Start and Stop codons in the mRNA?н но- Н о CH ОН -H ОН CH₂OH Cu2+ (aq)
- OHHH HHHH H H H HH -с-с-с-с-с-с-с-с-с-с-с-с-с HH H H H H H H H HHH H H H H H H H HHH H-C-O C-C- OH H H H H H H H H-C-0 C-C-C-C CH, H H H,CN-C-c-o-P-0-c-H CH, H H H H H H H H H c-c-c-o What do you call the structure enclosed in the rectangle? What type of chemical bond is represented by the structure with an arrow?. What structure does the bond identified in # 2 create in relation to the entire molecule shown? True or False: This molecule is non-amphipathic. (True or False) I-0-I16 please labelling itWhat is the Heimlich maneuver used for?
- 1. W-h-a-t- -d-o- -y-o-u- -t-h-i-n-k- -i-s- -t-h-e- -p-h-y-s-i-c-a-l- -a-n-d- -m-e-n-t-a-l- -h-e-a-l-t-h- -B-e-n-e-f-i-t-s- -o-f- -p-l-a-y-i-n-g- -v-ol-l-e-y-b-a-l-l-?- 2. G-i-v-e- -t-h-e- -i-m-p-o-r-t-a-n-c-e- -o-f- -b-a-l-l- -c-o-n-t-r-o-l-,- -s-e-t-t-i-n-g- -t-h-e- -b-a-l-l- -a-n-d- -s-e-r-v-i-n-g- -t-h-e- -b-a-l-l- -i-n- -p-l-a-y-i-n-g- -v-o-l-l-e-y-b-a-l-l-?-can u help me quikly1 2 3 4 NH2 NH2 NH2 Н-с H-c CH2 H-C H-C N NH2 CH2 H-C N-C CH2 CH2 H \H H/ \H H/ С — С H H H/ OH H но но 6. 7 NH2 NH2 NH2 H-C H-C CH2 H-C H-C CH2 CH2 CH2 NH2 \H H/ H H/ H \H H/ \H H/ H. OH H Он Он н но 6. 10 H-C H-C CH2 NH2 CH2 NH2 ターC \H H/ \H H/ он ОН он он Which of these molecules could be incorporated into primer during DNA replication? Select all that apply: 11. I. 4 IV. V. VI. VII. 8. YII. O =U