a) Q1 a. Justify why the base thyamine is petered over guanine in DNA while the reverse is preferreu' in RNA. Provide the chemistry involved to support your answer.
Q: In a mimimum of 25 sentences explain why subspecies are important in the field of taxonomy. Also…
A: Subspecies are group at the principal phase of speciation; people of various subspecies at times…
Q: What are the different stages of the follicular phase of the menstrual cycle taking place in ovary…
A: The stages of the follicular phase of the menstrual cycle occurring in the ovary and uterus are…
Q: A seed is a(n)_______ . a. female gametophyte c. mature pollen tube b. mature ovule d. immature…
A: A flower is a reproductive structure located in flowering plants ( angiosperms) that is also…
Q: On a hot, dry day, plants close their stomata to conserve water. Explain the connection between the…
A: Photosynthesis is the process by which green plants and certain other organisms transform light…
Q: Q.10. Mention the changes taking place during the transition of a primary follicle to Graafian…
A: Introduction We will answer the question in below step.
Q: What is the expected phenotypic ratio in the F1 of cross 6? A) 50% black females, 50% black males B)…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: Question 18 A 38-year-old man is attending a blood drive: 245lb; hemoglobin 16.5 g/dL; received…
A: Blood transfusion is a very common phenomena in medical science but it can have disasters effects if…
Q: Blood type O is also known as universal donor because it does not contain plasma antibodies. O True…
A: Blood group O is called as universal donor, because it doesn't contain any antigen on the surface…
Q: In Figure 17-19, is there any difference between the inversion products formed from breakage and…
A: GENETIC LINKAGE: When DNA sequences are found on the same chromosomes in the same location, this is…
Q: Which of the following statements is TRUE regarding the ABO blood system? A. People who have the…
A: ABO blood grouping It is the most important blood group/type system in human blood transfusion. ABO…
Q: The principle of Acquired Characteristics states that O species change because there is variation…
A: The characteristics in an organism is controlled by its genetic element that is the DNA. That DNA…
Q: Question 8 Which of the following is the correct order of mechanism of how sugar is perceived? 1.…
A: The tongue is present at the floor of the mouth. The sensory receptors are present within the taste…
Q: The base analog 5-bromouracil undergoes tautomerization. One tautomer behaves like thymine, and the…
A: Solution (5-Bromoracil comes in three tautomers, each with its own set of properties. Adenine is…
Q: minimum of 25 sentences, explain the concept of mimicry in relation to taxonomy and why it is…
A: Mimicry is a developed resemblence between an organism and another object, frequently an organism of…
Q: DNA = CGC AAA CTA AGC TAC ACT AGC GTT TTA ATT MRNA = TRNA = %3D
A: Central dogma DNA is the deoxyribonucleic acid and is the basic hereditary molecule of all…
Q: What does blood typing detect? presence of antigenic substances in the blood sample presence of…
A: Blood typing is one of the very important medical techniques that are used by doctors. It helps us…
Q: Why does Neostigmine cause an increase in the twitch tension when the nerve is stimulated and not…
A: Because neostigmine acts on nerve terminal increasing acetylcholine concentration by inhibiting…
Q: A patient had a blister on the toe that got infected, and several days later the area around the…
A: Impetigo is skin infection problem which usually indicated by skin rash and redness. It is usually…
Q: Most living organisms cannot survive at temperature above 45°C°. How are some microbes able to live…
A: Optimum temperature for survival of microbes is about 45°C. Some microbes like archaebacteria can…
Q: Which co-receptor molecules are common to both TC and TH cells and their respective antigen…
A: The CD2-LFA-3 and LFA-1-ICAM pathways relevance to T-cell recognition
Q: Question 12 Five sweetener samples (labelled A to E) were tested by 97 individuals for the intensity…
A: Humans have long been drawn to sweet foods. Since the dawn of time, humans have liked nutritive…
Q: Erythroblastosis fetalis is a hemolytic disease experienced by the second born caused by the…
A: Answer
Q: How do you think the evolution of mammals (including the emergence of humans) might have been…
A: Mammals evolved from members of the reptile order Therapsida during the Triassic Period…
Q: Consider a cherry pit, which is a seed with a cherry embryo inside it. Trace the paternal ancestry…
A: An embryo is an early stage of development for a multicellular organism. In general, an embryo…
Q: Proteins such as Dicer and RDE-R are involved in RNAi inactivation of target gene expression and are…
A: RNA is a molecule that plays several important roles in the cell. It functions as a messenger…
Q: What is the significance of Reproductive Health?
A: As defined by the World Health Organization (WHO), reproductive health refers to an individual's…
Q: Which of the following are characteristics of a temperate forest? Check all that apply.
A: A temperate forest is a forest that found between the tropical and boreal regions, located in the…
Q: In Gram-positive bacteria, peptidoglycan cross-link is formed by a peptide bond from the amino group…
A: In gram positive bacteria Peptidoglycan carries covalently attached cell surface components like…
Q: 1. List the major contributors to modern biology concepts in your own words, briefly describe their…
A: Darwin is considered the father of modern-day biology because he identified the not unusual…
Q: Question 2 Could you please explain the term ʼzoonosis'.
A: Introduction - An organism that causes disease is referred to as a pathogen. Microbes are abundant…
Q: Question: A rapid COVID antigen test: may result in a false positive if you test too early. detects…
A: COVID antigen test is used to detect the presence of SARS-CoV-2 viral proteins in our body directly…
Q: Define phenotypic adaptation. Give one example.
A: Introduction In this question we will discuss about the phenotypic adaptation.
Q: Well firm - limited smooth bulge on the hard palate of this 67 year old woman, painless so what is…
A: Introduction - Cancer is a broad term that describes a variety of disorders characterised by the…
Q: Question 4 Lipids are the biomolecules of choice for storage of metabolic energy because they: O…
A: Lipids are first hydrolysed to fatty acids and glycerol and then completely oxidised to produce…
Q: Explain the pollination occurring in the chasmogamous flowers.
A: Pollination is a critical part of plant replica. Pollen from a flower's anthers (the male part)…
Q: What are the habitat corridors in the Philippines?
A: The main function of the corridors is to connect biodiversity areas through a patchwork of…
Q: (a) Hip replacement surgery or total hip arthroplasty, involves removing a diseased hip joint and…
A: During hip alternative, a health practitioner eliminates the broken sections of your hip joint and…
Q: How does the first cycle of fatty acid degradation differ from the subsequent cycles?
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: Explain the concept of an evolutionary tree. Also, explain why it is significant.
A: Evolutionary tree, which is also known as phylogenetic tree, is a diagrammatic depiction of distinct…
Q: 2. If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: Answer :- Option (A) is correct. - 3.
Q: Match the feature or description with the type of animal v Cells divide asymmetrically and not…
A: Protostome and deuetrostome are way to classify organisms based on the formation of anus and mouth…
Q: Which of the following compounds is derived from arachidonic acid with the help of the enzyme…
A: Eicosanoids are polyunsaturated fatty acids that are synthesized from arachidonic acid .They are…
Q: Why does it take for α-amanitin to kill in patients who accidentally eats the mushroom, the death…
A: The DNA is the genetic material in living organisms that is composed of nucleotides. This DNA is…
Q: What slide preparation technique should you use to determine the chromosome number of a newly…
A: Microtechniques are set of approaches used in preparation of micro-objects for research. Two…
Q: What does blood typing detect? A. presence of antigenic substances in the blood sample B.…
A: Blood typing refers to the process of blood type determination. It uses specific antibodies to…
Q: 29. [3] Ignoring the seroprevalence rates, suppose a statistical analysis revealed that the QALY…
A: Answer :- Yes, Engerix-B or Recombivax-HB hepatitis B vaccines are interchangeable. However, if…
Q: Fifty-million sperm were examined for mutations in a specific gene and 100 mutations were found.…
A: Mutations can damage the DNA and cause changes in the genome which can further lead to changes in…
Q: Define decomposition and describe the processes and products of decomposition.
A: Inorganic decomposition is the breakdown of complex organic matter or biomass from the bodies of…
Q: 12. Population growth is limited by the following factors EXCEPT * litter size biotic potential…
A: The correct option is option B i.e. biotic potential. Biotic potential refers to the unrestricted…
Q: Illustrate the mechanism of action of Aýsozyme.
A: Animal and human lacrimal gland secretions (or tears), gastric secretions, nasal mucus, and egg…
Do (9)(a)
Step by step
Solved in 2 steps
- Consider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stackingH2N 1.) Look carefully at this nucleotide: N: N- Но-Р-О OH a.) Number the carbons in the sugar group. (Remember the "prime" symbols.) b.) Is this a purine or a pyrimidine? How do you know? c.) Would this nucleotide be used for DNA or RNA? How do you know? (Be specific.) d.) Is this nucleotide ready to be used for DNA replication or RNA transcription? Why/why not? e.) If this nucleotide were incorporated into a growing DNA or RNA strand, where would the next added nucleotide be attached to this one?. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.
- VII. Analysis of a peptide antibiotic purified from a strain of Bacillus brevii resulted in the following significant information: Complete hydrolysis of the peptide yielded equimolar amounts of Leu, Orn, Phe, Pro, and Val Molecular weight of the peptide was estimated to be aroung 1,200 Da The peptide failed to undergo hydrolysis when treated with carboxypeptidase Partial hydrolysis and then chromatographic separation of products yielded the following di- and tripeptides: Leu-Phe, Phe-Pro, Orn-Leu, Val-Orn, Val-Orn-Leu, Phe-Pro-Val, Pro-Val-Orn Treament with dinitrofluorobenzene (DNFB) followed by complete hydrolysis yielded only free amino acids and the DNFB-derivatized ornithine at its side chain Using this set of information available to you, deduce the amino acid sequence of this peptide antibiotic. Write your final peptide sequence only using 3-letter abbreviations. /2B Determine, justifying your answer, which of the following statements are true. i. A trinucleotide 5'-A-G-C-3' can be found in RNA. ii. The complement of the nucleotide of subquery a is 5'-T-C-G-3'. iii. This nucleotide will form 8 hydrogen bonds with its complementary one.2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).
- 33. Gel filtration chromatography shows that the molecular weight of a protein is 240,000 Daltons. However, when the protein was subjected to SDS-PAGE in the absence of ß- mercaptoethanol, two polypeptides (100,000 Daltons, 140,000 Daltons) were identified. Furthermore, when the protein was subjected to SDS-PAGE in the presence of ß- mercaptoethanol, three polypeptides (100,000 Daltons, 90,000 Daltons, and 50,000 Daltons) were identified. Which of the following statements is true of the protein? A. The protein is composed of three polypeptides. B. The three-dimensional structure of the protein is stabilized by both covalent and non- covalent bonds. C. Both A and B. D. Neither A nor B. 34. What is purpose of SDS in SDS-PAGE? E. To selectively bind the target protein F. To maintain buffer pH in the gel G. To cause the separation of proteins to be on the basis of molecular weight only H. To initiate polymerization of acrylamide to form gelb. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run the same way? d. How are the chains connected? e. Which bases bond to each other? f. What kinds of bonds hold the chain together? 3. What are the main differences between RNA and DNA? 4. Distinguish between the structure of pyrimidines and purines. Explain why adenine bonds only to thymine. 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B) hpN. NH 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. O=P-OCH, N. `NH, HN он O= P- OCH, NH, Chargaff noted that the molar quantity of A_was always approximately equal to the molar quantity of T. and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? N OH N. O= P-OCH, OH OH
- 1)What is the objective of hydrolyzing the RNA prior to doing biochemical tests? 2) What particular test, other than Molisch's, may be performed to determine the presence of pentose sugar? Create a process. 3) List the sugars, purines, and pyrimidine bases found in DNA and RNA and write down their structural formulae.6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.10.Suppose the following base sequence was found Complete the following: (10 points) nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter U A G UUU) Phe UCU UAU Tyr UGU Cys UAC J Ser UAA Stop UGA Stop UUC J UGC J UCC UCA UCG U UUA Leu UUG. UAG Stop UGG Trp G CUU CUC CUA CUG CU ССС ССА CG CAU CGU U CAC His CAA CGC Arg CGA Leu Pro Gln CAGJ CGG AUU ACU AAU AUC le A AUA ACC АCА AAC FAsn AAA AGU Ser AGC Thr AGG Arg G AGA AUG Met ACG AAGLYS GUU GUC GUA GUG GCU GCC GCA GCG GAUT GẠC, Ala GAA) GGU GGC Gly U Asp G Val GGA GAG Glu GGG First letter Third letter