A person of type A blood receives blood after a collision between a car and a bus. Shortly after, the person develops pain in their legs, shortness of breath, and partial paralysis on their left side. Provide a likely explanation of the causes of the symptoms Please answer asap and type your answer and do not copy from anywhere please answer asap

Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…

A: Transcription is the first step in the gene expression which transfers the genetic information…

Q: Choose the letter that DOES NOT BELONG ON THE LIST.  A. biodiesel  B. crude oil C. coal  D. natural…

A: The source of energy refers to fuels available on the earth. There are deposits of different fuels…

Q: ain also.

A: Jawless fishes are about 100 species. Bony fishes are about 58% if all species so, they are the…

Q: Name the two kinds of tissues present in the bone? a) Cancellous tissue and non-compact tissue b)…

A: Introduction - Compact tissue (the hard, outer layer) and cancellous tissue (the soft, inner layer)…

Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…

A: In this, the given paragraph includes the experimental process and the observations of…

Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…

A: A great number of diseases are caused due to multiple problems. And hypocomplementemia is such…

Q: Which cell secretes the matrix for bone formation? a) Osteoclastoma b) Osteoclast c) Mesoblasts d)…

A: Introduction - The creation of bones is known as osteogenesis or ossification. Following the…

Q: Compare and contrast exons and introns

A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…

Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…

A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…

Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…

A: LC-MS/MS-based method for the rapid and simultaneous relative quantitation of glycosidic linkages…

Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…

A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…

Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…

A: Sperms are the male gametes produced in the seminiferous tubule present in testicular lobules.…

Q: Ma nave 1. requires ATP A. diff 2. random movement of molecules from high to low B. fa 3. molecules…

A: Cell transport is a mechanism that brings about the movement of materials across the cell membrane.…

Q: What is the relationship between the severity of symptoms and the size of the chromosome involved in…

A: More the size of the chromosomes involved in the trisomy, more will be the severity of symptoms.…

Q: List two possible missense mutation effects on the new polypeptide.

A: *missense mutation occurs when there is  change in a single base pair that causes substitution of…

Q: What is mitosis? What is the importance of mitosis?

A: Cell division is the process by which a cell can divide itself into two cells. the process of cell…

Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…

A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…

Q: What is psedupodia

A: Introduction :- A pseudopodium is a transient protrusion of a eukaryotic cell's cytoplasm.

Q: Having a widows peak is dominant W to not having one (ww) Having attached earlobes is a recessive…

A: Introduction Dominant traits are those phenotypic characteristics or properties which are inherited…

Q: Summarize the passage “Walking and fat loss”., and describe the reasons why walking is not effective…

A: Walking is a shape of a low effect, moderate-intensity workout that has various health blessings and…

Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…

A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…

Q: explain also.

A: PABP (Poly A binding protein) is a RNA binding protein which triggers the binding of eukaryotic…

Q: How biofilm causes endocarditis in human

A: Endocarditis is an infection in which the germs attach to the inner lining or the valves of the…

Q: Conservation of developmental genes in evolution is supported by all of the observations except that…

A: INTRODUCTION A homeotic gene is a collection of genes that manage the pattern of body formation…

Q: se trhe imlage to arISwer the Posterior pituitary releases oxytocin Baby suckles Oxytocin stimulates…

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: Which of the following is/are the contents of the dorsal body cavity? A. heart and lungs B. brain…

A: Introduction - The cranial cavity, which houses the brain, and the spinal cavity, which houses the…

Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…

A: There are few important points: A population genetics is the study of changes in the frequencies of…

Q: The describes the situation where the gene pool of a population is determined by the genetics of a…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Construct a comparative matrix on different sterilization methods.

A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…

Q: True or false: A somatic cell mutation may be passed on to offspring

A: Somatic cells and germ cells are the two types of cells found in the body. Mutations in any of the…

Q: Abacteria isolated from Yellowstone National Park is found to use the chemical methane as a food…

A: Chemotrophs are organisms whose energy source is obtained by the oxidation of inorganic…

Q: You conduct a redox reaction experiment with mutiple metals and nitrate solutions. One of the…

A: ANSWER;-

Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a  slide without…

A: A simple microscope is a magnifying glass with a short focal length and a double convex lens. The…

Q: true or false: nondisjunction during meiosis is the cause of down syndrome

A: Down syndrome is caused by failure of chromosomes during meiosis. cell division which results in the…

Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…

A: The three point test cross data is given in the question. The three genes are involved in a three…

Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…

A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…

Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…

A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…

Q: 9. What slide preparation technique should you use for the following research goals? Briefly justify…

A: Answer :- a) Maceration technique  In maceration the complex substance is broken down into simple…

Q: A cell that proceeded to cell division without completing S phase would:

A: The first stage of the cell division is Interphase. Interphase is further divided into 3 stages -…

Q: What are the species of aerobic bacteria which can be found in chronic wound?

A: Introduction A wound is an injury that occurs quickly and involves lacerated or punctured skin (open…

Q: Which of the following are examples of species interactions where one species benefits and one…

A: Parasitism is the relation in which one species is benefitted and the other is harmed. In…

Q: Narcolepsy is thought to occur from dysfunction of neurons located in the hypothalamus hippocampus…

A: Introduction - Narcolepsy is a persistent sleep condition marked by excessive daytime sleepiness and…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: If you had a mixture of single-stranded DNA fragments, all 4 deoxyribonucleoside triphosphates, and…

A: DNA replication is the process of producing complementary DNA molecules from the ds DNA molecule.

Q: iscuss the intestinal phase of gastric secretion regulation with examples

A: The digestive system is involved in a variety of processes, including food digestion and nutrient…

Q: Why is Trisomy 21 more common than other trisomies (e.g. Trisomy 1, Trisomy 2, etc.)? The size of…

A: Answer :-(C)   Trisomy 21 are caused by nondisjunction, which occurs when pairs of homologous…

Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…

A: We are given the amount of each component present in liter of the culture. 3 g of Polypeptone is in…

Q: 1. Please describe the behavior of cranes. 2. How do peregrine falcons see the world?

A: Behaviour of Cranes.. #The cranes are diurnal birds that vary in their sociality by season and…

Q: A transition mutation would be replacing A by

A: Transition mutation is a process in molecular biology and genetics where it refers to point in…