Answered: A pea plant has the genotype rrYy. How…

Name: A pea plant has the genotype rrYy. How many different types ofgametes
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: A pea plant has the genotype rrYy. How many different types ofgametes can it make and in what proportions?a. 1 rr : 1 Yyb. 1 rY : 1 ryc. 3 rY : 1 ryd. 1 RY : 1 rY : 1 Ry : 1 ry

Science

Biology

A pea plant has the genotype rrYy. How many different types ofgametes can it make and in what proportions?a. 1 rr : 1 Yyb. 1 rY : 1 ryc. 3 rY : 1 ryd. 1 RY : 1 rY : 1 Ry : 1 ry

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter3: Transmission Of Genes From Generation To Generation

Section: Chapter Questions

Problem 20QP: More Crosses with Pea Plants: The Principle of Independent Assortment Consider the following cross:...

See similar textbooks

Similar questions

What are the possible genotype and phenotype of offspring if one pf the parent is heterozygous tall and the other parent is homozygous short Legend T- tall pea plant t- short pea plant Question 1. What is the genotypic ratio 2. What are the possible phenotypes of the offspring? 3. What is the phenotypic ratio 4. What is the percentage of having the tall trait.
What are all the possible genotypes of a round, yellow pea? Select all that apply. RRyy RRYY rrYy RRYY RRYY Rryy O RrYy O rrYY
Here are some descriptions and symbols that provide genetic information about pea plant 1. different form of each gene 2. RR , Rr 3. To’ tt 4. white flower colour Match the description above with each item below. Genotype ____ Phenotype ____ Allele ____ Monohybrid cross. ____
Supposing two strains of autotetraploid plants are available and their genotypes are as follows. Plant 1: AAaa - in this plant the gene is close to the centromere Plant 2: AAAa - in this plant the gene is far from the centromere The allele A for yellow stigma is completely dominant to green (aa).
. In corn, the allele s causes sugary endosperm, whereas Scauses starchy. What endosperm genotypes result fromeach of the following crosses?a. s/s female × S/S maleb. S/S female × s/s malec. S/s female × S/s male
Given : The given plant is triploid. Symbol For purple = P For yellow seed = Y For round seed = R Answer 1. The Probability of PpYyRr = 8/64 = 1/8 2. The Probability of PPyyRr = 4/64 = 1/16 3. Probability of at least exhibiting wrinkled seeds = 32/64 = 1/2 4. Probability of at least exhibiting purple flowers = 48/64 = 6/8 = 3/4 QUESTION: Answer the remaining question (5, 6, 7)
Mutations Adenosine triphosphate is an energy molecule found in cells and produced as a result of cellular respiration. Many enzymes are required for cellular respiration to produce an ATP molecule. The following is an original DNA segment from a sequence that codes for the production of an enzyme necessary for the production of ATP in organisms: Original DNA: TACAAGTTTAGTACGTATATGCCAACT A mutation occurred during replication that resulted in the following change in the segment of DNA: Mutated DNA: TACAAGTTTATGTACGTATATGCCAACT 1) Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred. 2) Evaluate the the significance of this mutation. a. How does this mutation affect the production of ATP? b. How will this mutation affect this organism cellular respiration process?
An individual pea plant is heterozygous for two loci: height and seed shape, with the genotype TtRr. These two loci are on different chromosomes and assort independently. What gametes are produced by this plant? Select all that apply. rr RR tr Tr tR tt TR TT TtRr
Imagine that you are performing a cross involving seed texture in garden pea plants. You cross true-breeding round and wrinkled parents to obtain F1 offspring. Which of the following experimental results in terms of numbers of plants are closest to what you expect in the F2 progeny? a. 8lOroundseeds b. 8lOwrinkledseeds c. 405:395 round seeds:wrinkled seeds d. 610:190 round seeds:wrinkled seeds
More Crosses with Pea Plants: The Principle of Independent Assortment Consider the following cross: P1: AABBCCDDEE aabbccddee F1: AaBbCcDdEe (self-cross to get F2) What is the chance of getting an AaBBccDdee individual in the F2 generation?
Use the following information about pea plants: S = spherical seeds; s = wrinkled seeds Y = yellow seeds; y = green seeds P = purple flowers; p = white flowers I = inflated pods; i = constricted pods Write the phenotype produced by the following genotypes: PP Pp SS ss SSPp IiPp IIPP
a. 1 dominant allele will contribute 120/10 = 12 cm to the base height of the plant.b. The height of the parent plant 1 Genotype of the parent plant 1 – D1D1D2D2D3D3d4d4d5d5 The height of the parent plant 2 Genotype of the parent plant 2 – d1d1d2d2d3d3D4D4D5D5Contributing alleles – D4D4D5D5. The height of the plant without any contributing alleles would be 80 cm. The plant with genotype d1d1d2d2d3d3D4D4D5D5 has 4 contributing allele each of which contributes 12 cm to the base. Hence, the height of the plant with genotype d1d1d2d2d3d3D4D4D5D5 would be 80 + 12 + 12 + 12 + 12 = 128 cm. c. Parents – D1D1D2D2D3D3d4d4d5d5 × d1d1d2d2d3d3D4D4D5D5 Gametes – D1D2D3d4d5 × d1d2d3D4D5 F1 generation – D1d1D2d2D3d3D4d4D5d5 The height of the plants of F1 generation = 80 + 12 + 12 + 12 + 12 + 12 = 140 cm Hence, Genotype of the F1 = D1d1D2d2D3d3D4d4D5d5 Phenotype of…