A Membrane potential (V) +50 mV +25 mV Omv -25 mV -50 mV - Open - Closed - Open - Closed - Closed -Open - Closed

Q: -11 -12 13 1. 14 2 15 16 3- 4 -17 18 -19 6 -20 7- -21 OBDES 9. -22 10 23

A: The circulatory system's most important organ is the heart. Its primary function as a hollow,…

Q: hi can you please help me review this vedio including vedio topic presented, the information…

A: The video provides a comprehensive overview of the COVID-19 outbreak in Wuhan and raises important…

Q: scleritis causes sticky eye I need answer within 1 minutes with my best wishes ton .A true .B false

A: Scleritis : it is the inflammation of sclera. Sclera is the outer 5/6th part of fibrous coat of eye.…

Q: 1 2 O Giovanni Perez SECTION

A: Dogfish The family of dogfish is Squalidae. Spiny dogfish is the best known species and pacific…

Q: ER 1ZER TIZER GEL

A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…

Q: i want a little story about hepatitis b

A: Liver disorder A medical condition that disturbs the structure and functions of liver is called…

Q: 7. Describe the important events in the process below. AUGG 1 GUAUC

A: Protein synthesis occurs in the ribosomes by the process called translation. It involves the…

Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…

A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…

Q: Pr 11 The highlighted structure is the Last saved 5:19:27 PM Questions Filter (25) ▼ e O K First…

A: The study of anatomy helps us identifying the structure of a particular organ in our body and their…

Q: HO H H H. HO OH HO H. H. H. Но H. OH ÓH 1,1 1,2 1,3 1,4 1,5 1,6

A: Introduction: A glycosidic bond is a type of covalent bond that connects a carbohydrate molecule to…

Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…

A: Cystic fibrosis is a disease of the mucus secretion in which thick viscid mucus is secreted which…

Q: Help me please! I cant do this anymore Identify the body cavities involved in each surgery. WRITE…

A: The body cavities are fluid filled space. This cavity is play an important role in protecting the…

Q: why are health prevention programs so crucial to the individual?

A: Health prevention programs are programs that help to prevent any disease condition and to promote…

Q: 12

A: Introduction: The cell is regarded as the fundamental unit of life as all tissues, and any organized…

Q: Rearrange the jumbled word and find the correct term and define

A: Scientific terms are used to specifically present a substance or a molecule or an event or a…

Q: 3a. Based on the pedigree below, what is the most likely form of inheritance for the genetic…

A: Pedigree analysis is the study of the inheritance of genes in humans. It helps in identifying…

Q: the first bipedal hominin had a brain no larger than that of a chimpanzee b.) a large brain size…

A: There are innumerable theories that try to explain the process of evolution. Out of which some of…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…

A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…

Q: a b. C d- g h

A: A. Endosperm, B. Epicotyl, C. Plumule D. Hylum, E. Micropyle F. PLumule G. Hypocotyle H. Epicotyle…

Q: Br2 COOH CCl4

A: b.

Q: How was the hepatitis B vaccine produced?

A: Introduction: A severe viral infection that harms the liver is hepatitis B. It is brought on by the…

Q: Dermatology - Pronouncing, Spelling, and Dissecting Use the pronunciations to correctly spell the…

A: Introduction Dermatology is a specialty of medicine that focuses on skin conditions and disorders.…

Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…

A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…

Q: be sure your answer is correct if u know correct answer then u try  i have last posting please…

A: Any bumpy or outgrowth on the skin is considered to be as a skin lesion.

Q: 1. What are all the possible ways to break the chain of infection, specifically a bacteria or virus…

A: The spread of an infection within a community is described as a “chain,”  that consists of several…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: 3. How could you find the relative age of a sedimentary rock? 4. How might pieces of an igneous rock…

A: Sedimentary rocks are formed over years and it appears in layers. The bottom most akter is the…

Q: I am confused what is HDI. pls define in easy words.

A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…

Q: Draw and label the following parts: (a) membrane coverings of gonads (b) supporting cells of gonad…

A: (a) The membranes covering the male gonads (testis) are: (1) Tunica vaginalis, (2) Tunica albuginea,…

Q: قارن بين فحص spt و cpt

A: The Blood Allergy Test (CPT) and the Skin Prick Test (SPT) are two popular tests used to diagnose…

Q: Can you help please

A: We know that the Heart, blood vessels namely arteries and veins, and blood work together to form the…

Q: Question 2- Notes G Line Guide Reset Answer Use the information below to answer the question. Com…

A: All the plants are able to fix atmospheric carbon dioxide into their biomass by the process of…

Q: I need help asap thanks

A: There are 8 cranial bones in which the Frontal bone is the flat bone comprising of forehead and…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Listen III Name this tissue. Be specific the lines (or bands) the blue arrows are pointing to. A/ A/…

A: Introduction :- In biology, a tissue is described as a collection of cells that have a same…

Q: CH OH CH -Q OH HHHHHHHHH CH CH C-C-C-C-C-C-C-C-C-C-H HO H. HHHHHHHHH CH-CH OH H. H. OH OH H

A: Biomolecules are substances that are present in living beings. The biomolecules are formed of…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.