Consider the following original coding sequence of a gene that codes for a short 5-amino acid polypeptide:5'-ATGGGCTCGAACTCATAA-3'Using the genetic code and the amino acid table below, which of the followingsequences arises from a non-conservative missense mutation in the originalsequence shown above?First base in codonUUAUUUUUC-UUAUUG-CUUCUCCUACUG-UPhe (F)Leu (L)Leu (L)Second base in codonVal (V)UCU -UCCUCAUCGCCUCCCCCACCGAUUACU-AUC Ile (1)ACCAUA-ACAAUG Met (M) start ACGGUUGCU-GUCGCCGUAGCAGUGGCG-CSer (S)Pro (P)Thr (T)Ala (A)UAUUACUAATUAGCAUCACCAACAGAAUAACAAAAAGGAUGACGAAGAGATyr (Y)STOPHis (H)Gln (Q)Asn (N)Lys (K)Asp (D)Glu (E)GUGUUGCUGA STOPUGG Trp (W)Cys (C)CGUCGCCGACGGAGUAGCAGA 1AGGGGU-GGCGGAGGGArg (R)Ser (S)Arg (R)Gly (G)UCAGUCAGUCAGUCAGLast base in codon Side chain (R group)HH₂N+ CTH-C-0Glycine(Gly or G)OCH₂SCH₂CH₂H₂N+ C C-OHMethionine(Met or M)Serine(Ser or S)OHCH₂H₂N-C- -C- OHOPolar side chains; hydrophilicOOCH₂2₂H₂N+ CCH3H₂N-C-C-0-ноAlanine(Ala or A)OH CH3CHH₂N+ C -C -0IHOH OAspartic acid(Asp or D)Threonine(Thr or T)Electrically charged side chains; hydrophilicCH₂H₂N+ C-CAcidic (negatively charged)-0-H OPhenylalanine(Phe or F)H₂N+ COCH₂CH₂H₂N+ CTH-0-H OGlutamic acid(Glu or E)0SHCH₂H₂N+ C -C -0IH OOCysteine(Cys or C)CH3 CH3CHValine(Val or V)NH₂+CH₂CH₂2CH₂CH₂H₂N-C-||OHLysine(Lys or K)CH₂H₂N+ C-C|H OTyrosine(Tyr or Y)CH3 CH3CHCH₂2H₂N-C-C-0| ||HOOHCH₂H₂N-C-C-0NHHOTryptophan(Trp or W)Leucine(Leu or L)0-0- H₂N-CNH, OCH₂H₂N-CBasic (positively charged)NH₂CNH,NHCH₂CH₂CH₂HOAsparagine(Asn or N)OIHArginine(Arg or R)-C-0-H₂CH₂N+CH₂CH₂H₂C-CHH₂N-CCH₂H OIsoleucine(lle or I)CH₂сH OProline(Pro or P)0 H₂N+-NH+-NHс -0U=O0NH₂‚_—_—_—_—_—_J_TH0CH₂H₂N-C-C-0-HHistidine(His or H)Glutamine(Gln or Q)O-0

A non-conservative missense mutation is a type of point mutation that results in the substitution of…

Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G U Phe (F) UUU UUC- UUA UUG CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC lle (1) ACC AUA- ACA AUG Met (M) start ACG GUU- GCU GUC GCC GUA GCA GUG GCG Leu (L) Leu (L) Second base Val (V) UCU UCC UCA UCG C Ser (S) Pro (P) Thr (T) Ala (A) codon UAU UAC UAA UAG- GAU- GAC- GAA GAG A Tyr (Y) CAU CAC CAAT CAG- AAU AAC AAA AAG STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys (C) Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A داواolcاد G U C A G U C A G Last base in codon

Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G U Phe (F) UUU UUC- UUA UUG CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC lle (1) ACC AUA- ACA AUG Met (M) start ACG GUU- GCU GUC GCC GUA GCA GUG GCG Leu (L) Leu (L) Second base Val (V) UCU UCC UCA UCG C Ser (S) Pro (P) Thr (T) Ala (A) codon UAU UAC UAA UAG- GAU- GAC- GAA GAG A Tyr (Y) CAU CAC CAAT CAG- AAU AAC AAA AAG STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys (C) Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A داواolcاد G U C A G U C A G Last base in codon

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
The following polynucleotide was synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. · AUAUAUAUAUAUAU- .. What polypeptide would you expect to be produced? What information would this give you about the code?
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’