5) Remove codons 24 to 66, including codon 66. AUG/UUU/GUA/CAU/UUG/UGU/GGG/AGU/CAC/CUG/GUU/GAG/GCG/UUG/UAU/UUG/GUU/ UGU/GGC/GAG/CGC/GCC/UUU/UUC/UAU/ACC/AGA/AGG/GAG/GAU/UUG/CAA/GUU/GGC/ CAA/GAA/UUA/GGC/GGC/GGU/CCC/GGG/GCG/GCG/GGG/AGU/CUU/CAA/CCA/AGU/CUG/ CAA/AAA/CGG/GGC/AUU/GUU/GAA/CAA/UGU/ACC/AGU/AUU/GUC/AGU/CUC/UAC/CAG/U UA/GAG/AAU/UAC/UGA AUG/UUU/GUA/CAU/UUG/UGU/GGG/AGU/CAC/CUG/GUU/GAG/GCG/UUG/UAU/UUG/GUU/ UGU/GGC/GAG/CGC/GCC/UUU/UAC/CAG/UUA/GAG/AAU/UAC/UGA This codon is incorrect. (g) Provide the anticodon sequence that would build this protein. UAC AAA CAU CUA BAA CÁC ACC CUC AGLLGGA CỦA ALIC GCC AAC ALIA AAA CỦA AAC AAC GCC UCG CGC CGA AAA AUG GUC AUC UUC UUG AGU Your codons here are incorrect. Double check your sequence from question 5 when you translate the anti-codon. 8:06 114 ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCOCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAA CATGGTCATAAACGTCAGAGATGGTCAATCTCTTAAT GACT Sequence C have to identify the beginning fragment, the middle fragment, TACAAACATGTAAACACACCCTCAGTGGACCAACTC and the end fragment. Procedure 1. Copy each of the followingquences onto a separate piece of paper. CGCA ACATAAACCAAACACCGCTCGCGCCGAAAAA GATATGG 2. Divide the sequences into triplets (codons) by putting a slash between each group of three bases. ACTIVITY 5.4.1 continued 3. Transcribe the DNA into mRNA. 4. Identify the middle, end, and beginning sequence. Use your knowledge of start and stop codons to help you figure it out. 5. Remove codons 24 to 66, including codon 66. 6. Translate the mRNA into protein using the genetic code. Analysis (a) Which fragment was the beginning fragment? How do you know? >) Which fragment was the end fragment? How do you know? c) Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision? (d) How many amino acids does this protein contain? (e) Is this genetic sequence eukaryotic or prokaryotic? How do you know? (f) If you worked backward, starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not? (g) Provide the anticodon sequence that would build this protein.

PLEASE use in your own words and NOT outside sources just provide the answer itself in brief sentences THANK YOU! 1. When you stand up, gravity causes blood to pool in your legs and abdomen. This decreases arterial blood pressure because there's less blood circulating back to your heart, leading to a condition called orthostatic hypotension. Describe the baroreceptor reflexes in response to this drop in blood pressure. Be as specific as possible.

Answer letter a,b,d, and e pls.

assessments/797859/variants/843068/take/9/ Question 9 1. Identify the type of tissue in the image below. 2. Support your answer using details from the image that describe the tissue. Answer using 2 to 4 complete sentences. ó õ õ õ ö ö õ 7 of 10 Total Questions Answered All Changes Saved V w 2 2 ✰ ✰ 0 : 4x Continue > 8:14 PM 10/12/2022

An aneurysm which appears as a balloon-like swelling on the side of an artery is a ____.   (It looks like a bubble gum bubble)     fusiform     infectious     saccular     sclerotic

9 X 11 My 11 My accoun: X *C C Broward Pax Opportunit x * ZG Session TX e AD HESI | Case X sevier.com/#/content-player?assessmentVtwld=afcd4cb0-17dd-4437-82f1-ce5cb069ddf9&instanceld-bundle_2207609 b n.com - Onli... New Tab Imported From IE Farmasion. (Enter the numerical value omy, in tounding is necessary, round to the rice tenth.) mL 1 Submit Lo Question 2 of 24 Before giving the initial dose of pain medication or antibiotic, which action should the nurse take first? Ask the client what liquid he would like to drink to swallow the pill. Teach the client the side effects of the medication. Ask the client if he is aware of any allergies to medications. Instruct the client to sit upright to swallow the medication. hp fg f5 Question 3 of 24 f6 J 17 - fe k fio fi ins delete

What are the medication for congenital diaphragmatic hernia ? Thank you.

Place each sign in the correct category based on whether it is a sign of heart attack or stroke Heart attack Stroke