5) Remove codons 24 to 66, including codon 66. AUG/UUU/GUA/CAU/UUG/UGU/GGG/AGU/CAC/CUG/GUU/GAG/GCG/UUG/UAU/UUG/GUU/ UGU/GGC/GAG/CGC/GCC/UUU/UUC/UAU/ACC/AGA/AGG/GAG/GAU/UUG/CAA/GUU/GGC/ CAA/GAA/UUA/GGC/GGC/GGU/CCC/GGG/GCG/GCG/GGG/AGU/CUU/CAA/CCA/AGU/CUG/ CAA/AAA/CGG/GGC/AUU/GUU/GAA/CAA/UGU/ACC/AGU/AUU/GUC/AGU/CUC/UAC/CAG/U UA/GAG/AAU/UAC/UGA AUG/UUU/GUA/CAU/UUG/UGU/GGG/AGU/CAC/CUG/GUU/GAG/GCG/UUG/UAU/UUG/GUU/ UGU/GGC/GAG/CGC/GCC/UUU/UAC/CAG/UUA/GAG/AAU/UAC/UGA This codon is incorrect. (g) Provide the anticodon sequence that would build this protein. UAC AAA CAU CUA BAA CÁC ACC CUC AGLLGGA CỦA ALIC GCC AAC ALIA AAA CỦA AAC AAC GCC UCG CGC CGA AAA AUG GUC AUC UUC UUG AGU Your codons here are incorrect. Double check your sequence from question 5 when you translate the anti-codon. 8:06 114 ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCOCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAA CATGGTCATAAACGTCAGAGATGGTCAATCTCTTAAT GACT Sequence C have to identify the beginning fragment, the middle fragment, TACAAACATGTAAACACACCCTCAGTGGACCAACTC and the end fragment. Procedure 1. Copy each of the followingquences onto a separate piece of paper. CGCA ACATAAACCAAACACCGCTCGCGCCGAAAAA GATATGG 2. Divide the sequences into triplets (codons) by putting a slash between each group of three bases. ACTIVITY 5.4.1 continued 3. Transcribe the DNA into mRNA. 4. Identify the middle, end, and beginning sequence. Use your knowledge of start and stop codons to help you figure it out. 5. Remove codons 24 to 66, including codon 66. 6. Translate the mRNA into protein using the genetic code. Analysis (a) Which fragment was the beginning fragment? How do you know? >) Which fragment was the end fragment? How do you know? c) Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision? (d) How many amino acids does this protein contain? (e) Is this genetic sequence eukaryotic or prokaryotic? How do you know? (f) If you worked backward, starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not? (g) Provide the anticodon sequence that would build this protein.

A: Anyone who gets admitted to the hospital for a procedure needs to fill out standard set of patient…

A: You have to answer the fill in the blanks. The answers are in the snowballs jumbled. Name the…

A: Drugs affect how neurons use neurotransmitters to send, receive, and process signals. Because some…

A: The propagation of nerve impulses from one neuron to the next neuron occur at the synapse. The axon…

A: Asexual reproduction involves only a single parent while sexual reproduction involves two parents as…

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

A: A simple , safe and effective way to protect ourselves against harmful disease before come into…

A: Chi square test is used to measure the relationships between categorical variables in a population.…

A: Phosphorus  Symbol - P Atomic no.(No. Of protons) - 15 Atomic mass - 31

A: The mentioned diagram describes skin anatomy.

A: Step 1: The age of consent (the age at which a person is considered to have full legal capacity to…

A: There is a pair of collar bones present in humans. Collar's bones are also known as the clavicle.…

A: The cervical vertebrae are the bones of the vertebral column through which the spinal cord passes…