7. Draw the protein: SRDR
Q: 1. Match each term with its definition.
A: Bone is a rigid tissue that makes human skeleton. Body fluids are liquid within the human body.
Q: 2i A person is given an intravenous infusion of distilled water in it rather than of saline.…
A: Blood is a fluid that is made of plasma and blood cells. There are three types of blood cells: red…
Q: 3. A mixture of proteins will be separated on a gel filtration column. The first peak elutes in 12…
A: Gel filtration chromatography is a technique in which the separation of components is based on the…
Q: 4. What happens when urine is allowed to stand for sometime?
A: Urine is a liquid waste product of human and another animal metabolism. The urinary bladder receives…
Q: 32. Serum difars from blood In tal kacking globulins (b) lacking albumins (c) lacking clotting…
A: Blood is a body fluid that transports oxygen and nutrients to the cells and carries away carbon…
Q: Fill in the blank: The shape of a red blood cell can be described as a _______________________…
A: Blood cells are also called as hemocyte, hematopoietic cell, or hematocyte. It is a cell generated…
Q: The purpose of this research was not to test the functionality of the transplanted kidneys, but…
A: Kidneys are paired bean shaped organs. The remove excess water, toxins, wastes from the blood in…
Q: 1.Explain the mechanism as to how the following can be used to visualize cells: Antibodies and…
A: Answer: Staining : It is the process of colouring or dyeing the cellular components of plants,…
Q: Hemoglobin OA. Defense proteins B. Transport proteins O c. Messenger proteins O D. Catalytic…
A: Proteins are large biomolecules and macromolecules that comprise one or more long chains of amino…
Q: 3 Which of the following is not an antigen that may be found on the surface of an erythrocyte? a. A…
A: 3) red blood cells is a type of cell found in the blood , formed from the bone arrow . it is a non…
Q: ONo.16:-After somatic death and for organ transplantation kidney must be taken within- a) 15minutes…
A: Warm ischemia time(WIT) It is a period which begins at the time of removal of the procured organ…
Q: Fill in the blank: White blood cells are also called _______________________.
A: Blood is composed of 45% of blood cells and 55% of plasma, the blood’s liquid component. There are…
Q: from having too many red blood cells.50. Researchers are now developingartificial blood for…
A: Blood is a fluid connective tissue that is responsible for providing oxygen and nutrients to all the…
Q: Describe what happens inside the filtering unit of the kidney
A: According to bartleby expert guidelines when multiple questions are posted we are allowed to answer…
Q: 2- a) Draw the structures of the three antigens that determine the blood type in humans. i.e. draw…
A: Blood group is determined by the presence and absence of the antigen. The plasma membrane of RBCs…
Q: 1. Under the microscope is a slide of healthy blood (left) compared with that from an inherited…
A: Red blood cell is flexible and assumes a bell shape as it passes through extremely small blood…
Q: Which cells in our body are popularlycalled “soldiers of the human body”?A. Red blood cellsB.…
A: The property of body to fight against various diseases that are caused by microorganisms and…
Q: 37. The protein concentration is highest in the: a. Plasma b. Interstitial fluid c. Intracellular…
A: The protein is composed of amino acids and it is synthesize by the ribosomes inside of the cell. In…
Q: 1. Describe the process of urine formation in our body.
A: The urinary system, also referred to as renal system or urinary tract that will produce, store, and…
Q: 8. A woman has normal blood clotting but testing indicated that she is a carrier of hemophilia. Her…
A: Haemophilia is an X linked recessive disorder. Let, XH - normal X chromosome and Xh - haemophilic…
Q: 2. Using Affinity chromatography, the protein that will be eluted LAST in an antigen containing…
A: There are different techniques to separate a molecule from a mixture of molecules. The separation…
Q: 9- Which one is not a chromosomal disease? a) Von Recklinghausen disease b) Patau disease c) Edward…
A: In this question it is to describe that which is not a chromosomal disorder.
Q: 4. What is the usage of the dialysis machine?
A: Kidneys are part of excretory system in humans they are involved in urine formation. Animals…
Q: 4 ree floating MHCII
A: As we know The proteins that bind to the body's foreign invaders are known as antibodies in the…
Q: 3. With proper diagrams, define the following terms: i. Maceration i. Percolation
A: The skin is the largest organ of the body and forms the outer layer. The primary function of the…
Q: 1. Describe how do you make monoclonal antibodies for a new protein that you have isolated. Name 2…
A: Genes produce proteins as their final products. DNA is converted to mRNA, which is then translated…
Q: What determines human blood groups? Group of answer choices None of these answers. protein…
A: Introduction :- In case of types of human blood groups , more than 24 types of blood group are…
Q: 14. An antibody can be best described as a A.white blood cells that engulfs an invading microbe B.…
A: Antibody - A protein made by plasma cells (a type of white blood cell) in response to an antigen (a…
Q: 5. You observe a blood agar plate and see a clear/transparent area where the bacteria has been…
A: Blood agar is enriched medium used to differentiate bacteria based on their hemolytic properties.
Q: 4. Under the microscope is a slide of healthy blood (left) compared with that from an inherited…
A: BLOOD:- Blood is connective tissue. It is the softest connective tissue. Blood divides into two…
Q: 5. State how transporters are involved in the absorption, distribution and elimination of drugs.
A:
Q: An antibody binds to an antigen with a Kd of 5 × 10−8 M. At what concentration of antigen will Y be…
A: Kd is considered as the dissociation constant of the ligand which gives half of the saturation (Y)…
Q: 5. Explain how a child can receive a different blood type than either parent using an example from…
A: ABO blood group is controlled by the multiple alleles. ABO blood group is controlled by three gene…
Q: 1) What is an obvious physical difference between an immunoglobulin (an antibody) and glucose (a…
A: Immunoglobulins are also known as antibodies. They are glycoproteins which are produced by white…
Q: When performing a routine urinalysis you observe a 1 leukocyte esterase. No cells are seen upon…
A: In a healthcare setting to provide adequate treatment, it is necessary to know the proper cause of…
Q: woman with type A+ blood can have a baby who's healthy with type B+ blood
A: Hemolytic transfusion It is antigen antibody reaction which leads to the serious complication…
Q: 7. The following antigens are present: D, c, E, and e. Determine the possible genotypes. (hint:…
A: Note: We’ll answer the first question since the exact one wasn’t specified. Please submit a new…
Q: . Illustrate the body areas and membranes where serous fluid is produced. 2. Tabulate and…
A: Ans. The fluid fills the inside of body cavities. Serous fluid originates from serous glands, with…
Q: The number of white blood cells in the circulating blood is 4,300 to 10,800 per milliter and their…
A: White blood cells are also called leukocytes and they account for 1% of the blood. The different…
Q: * .Plasma cells make antibodies F O
A: Plasma cells:- Plasma cells is type of white blood cells, plasma cells also called Plasma B cells,…
Q: If you get dark purple color upon adding ninhydrin to a substance and after boiling, then the…
A: A ninhydrin test is used to check the presence of amines or alpha-amino acid in the given solution.…
Q: 4. If you drink a lot of water, you may produce large amounts of urine that has a light yellow…
A: Introduction: Water is an extremely valuable natural resource. Water is required for the survival of…
Q: 3. What role is played by intermolecular forces in the human immune system?
A: Intermolecular forces (IMF) are the type of forces, which exhibits interactions between the two…
Q: 7. During an infection, the body temperature set point is increased. The hypothalamus communicates…
A: Body heat is produced as a result of the cellular metabolism. The muscle activities that cause the…
Q: 3. Why is an Rh control tube necessary?
A: The Rh factor is one of the proteins on RBCs that determines whether the blood of two persons is…
Step by step
Solved in 2 steps with 1 images
- PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTCBased on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
- Transcribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’Tyr Ulla Unigriffin DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | MRNA: amino acids: traits:(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
- DNAT A C C A C C C C C G T A T G G C T G G G A A T A T C mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______Sickle cell hemoglobin DNA CA CG TAGACTGAGGACA C Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence ValoHis.lku thro proo Gily 4. What type of mutation is this? Please explain why.Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp