6.Which of the following lists the structures of the male reproductive tract in the proper order from sperm production to ejaculation? (This is a multiple choice question choose the answer from the choices below) A.vas deferens; epididymis; seminal vesicles; ejaculatory duct; urethra B.seminal vesicles; vas deferens; prostate; urethra; ejaculatory duct C.seminiferous tubules; epididymis; vas deferens; ejaculatory duct; urethra D.seminal vesicles; vas deferens; urethra; prostate; ejaculatory duct

Q: Two tandem repeats have tested positive for a murder suspect. To determine the probability of any…

A: Tandem repeats is repeatition for multiple time of short length gene in a DNA sequence also called…

Q: Using the following hypotheses, formulate a testable prediction for each.   HYPOTHESIS: When planted…

A: Asparagus Beetle is an important pest of asparagus plant. It needs to be controlled otherwise it…

Q: Sketch the basic structures of amino acids, nucleotides, monosaccharides, and fatty acids.

A: Amino acid is the building block of proteins. Various amino acida are linked together to form…

Q: C. The patient has a pneumonia infection in both lungs. a. Place the patient on bed rest and…

A: Pneumonia is a typical problem that influences a huge number of individuals every year. Germs such…

Q: . Describe which enzymes are required for lactose and tryptophan metabolism in bacteria when lactose…

A: ANS 1.The enzymes of the lactose operon are needed to break down and use lactose as an energy…

Q: Which of the following structures are associated with the ends of chromosomes and may shorten over…

A: Chromosomes are thread like structure made of a single molecule of DNA associated with proteins.…

Q: The figure depicts the countries in South Africa, countries with confirmed Omicron cases, and…

A: SARV - CoV2 is a contagious disease and can spread easily from person to person through contact,…

Q: Describe the distinguishing characteristics of fungi.

A: Introduction Fungi are unique species characterised by their own biological kingdom, which means…

Q: Lymphoid organs are divided into primary and secondary peripheral organs. Briefly describe thymus…

A: The primary lymphoid organs are the red bone marrow, wherein blood and immune cells are produced and…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Inside a body, this reaction has a value of positive ∆G   C6H12O6 + H3PO4 → C6H14O12P2 + H2O ∆G=…

A: For any reaction to keep going in the forward direction it needs to have negative value of ∆G. It is…

Q: write 5 Neurological tests of the spine,5 tests for the spinal joints and 5 special tests of the…

A: A neurological exam, sometimes known as a neuro exam, is a test that evaluates a person's nervous…

Q: 1. If an inherited traits displays variation in a population, then the trait is considered: 2. A…

A: Introduction Genetics:- It is the study of genes and tries to explain what they are and how they…

Q: Explain the roles of mRNA and tRNA during the synthesis of proteins. In your answer explain how the…

A: The translation is the process that involves production of polypeptide chain or protein from the…

Q: A tennis player has recently decided to take up squas her wrist while swinging a paddle because…

A: Tennis is defined as an indoor or outdoor game that is played with rackets and a light elastic ball…

Q: How many sets of human chromosomes are in each of the following cell types? a. an oogonium b. a…

A: INTRODUCTION Chromosome It is a thread like structure present inside the nucleus contains protein…

Q: How is RT PCR used to detect Ebola? How does the actual RT PCR procedure work? How is ELISA used to…

A: SOLUTIONThe RT-PCR and antigen-capture diagnostic assays proved very effective for detecting…

Q: Which of the following would not be considered a polymorphism? O A) Phenotypic traits that vary in…

A: The external characteristics of an individual is known as phenotype which is controlled by genes. In…

Q: The 1918 influenza strain killed millions of people world-wide. After recovering virus from…

A: The influenza virus, which infects the respiratory tract, causes influenza. The influenza virus is…

Q: Which of the following is NOT regulated by glucagon? Glut-4 transporters O protein kinase A O…

A: The blood glucose concentration is highly regulated by the activity of two hormones that are insulin…

Q: If you discovered a fossil hominin that was adapted for both arboreal and bipedal locomotion, had an…

A: Introduction Bipedalism is a type of terrestrial locomotion in which an organism moves by using its…

Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…

A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…

Q: Give the common name of the following: answer 1,2,3,4,5,6,7,8,9,10. 1. Fasciola gigantica 2.…

A: A name of any type of species which is generally used by people and is not common for every person…

Q: The blood vessel which supplies blood to the liver.

A: There are two blood vessels which supply blood to the liver, namely hepatic artery and portal vein.…

Q: 3:39 PM A © O 1 Edit f 88 8 Convert this document and share it as an Share image 1, The cell cycle…

A: A cell's life cycle is said as the cell cycle. In different words, it is the method of growth and…

Q: Essay: In your own words explain the following concept in not more than 5 sentences a. The lock and…

A: A. The lock and key model showing enzyme-substrate interaction. In which the substrate behave like…

Q: Explain the diagram below.

A: The living organisms always try to maintain homeostasis of their internal environment. The glucose…

Q: D Question 2 The type of protein made by a ribosome is determined by O the Keebler Elves. O introns.…

A: Proteins are made up of amino acids. Long-chain amino acids are called polypeptides.

Q: 8.During muscular contraction, cross-bridges form between _____ and _____ .(This is a multiple…

A: Introduction :- When the thin actin and thick myosin filaments slide past each other, muscle…

Q: quantitative traits, such as height and weight, that do not fall into discrete categories, are…

A: quantitative traits, such as height and weight, that do not fall into discrete categories, are…

Q: Explain the functions of toll-like receptors with THREE (3) examples.

A: Here i explain the functions of toll like receptors with example.

Q: With reference to the Penman-Monteith 56 equation, discuss how the leaf/canopy and climatic factors…

A:

Q: Name the following: (i) The organization which procures and supplies blood during an emergency.

A: Introduction Blood is a body fluid located in the circulatory system of humans and other animals…

Q: FOR DIRECT MEASUREMENT OF THE RELATIVE AIR HUMIDITY USE THE APPLIANCE 1. psychrometer 2. barometer…

A: The quantity of water vapor in the air is known as humidity. The humidity would be high in case of…

Q: connection and correlation is there between the red-shouldered hawk, the pacific madrone, and the…

A: NOTE: Please note that as per our company's honor code, citing external references is not allowed.…

Q: You have two populations of snakes in different enclosures in a zoo. In enclosure A the frequency…

A: Answer :- Option (A) is correct. - 0.7

Q: Some traits that can be counted and expressed I. Whole numbers Such as bristle number in Drosophila…

A: The genetic basis of variance for quantitative features can be elucidated using the number of…

Q: Which of the following statements concerning the evolution of behavior is correct? A. Natural…

A: Behavioral evolution can include sensory system alterations, brain changes, and even physical…

Q: Match the number with the appropriate bone: 2 - 10 11 12 5 13 14 15 Frontal Bone [ Choose ] Maxilla…

A: The center of the nervous system in both invertebrate and vertebrate organisms is the brain. The…

Q: Which statement is not true of the zygomycetes? (a) many members of this group form endomycorrhizae…

A: Introduction :- The Zygomycetes, also known as 'pin moulds,' are true fungi that form extended…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Why was sequencing the human genome such a formidable task?

A: Human Genome Project is a project which tells about the DNA sequence of the complete human genome.…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: Inflammation of the glomerular capsular filtering apparatus, as seen in glomerulonephritis, results…

A: Glomerulonephritis- is a term used to refer to several kidney disorders, usually affecting both…

Q: Which is the odd man out based on the third appendage? Asiomorpha, Tachypleus, Menalaides, or…

A: An appendage (or outgrowth) is an external body part, or natural prolongation, that protrudes from…

Q: What phase of meiosis do chromatids align on spindle

A: Meiosis is a special type of cell division in which germ cells are sexually-reproducing organisms…

Q: Describe how diversity is achieved in polymers, using proteins as an example.

A: Introduction  Protein is the key biomolecule in the biological system, any important physiological…

Q: 19.Which among the following statements is NOT an important function of skeletal system?(This is a…

A: Calcium homeostasis regulates the flow of calcium to and from bones. If calcium levels are…

Q: It seems paradoxical that a lipid bilayer can be fluid yet asymmetrical. Explain.

A: Introduction :- The lipid bilayer (also known as the phospholipid bilayer) is a thin polar membrane…