6 What is the purpose of the control prepared in step #9 above? EXERC 7 You dilute your bacteriophage for plating 10-6. You mix 0.1 ml of the bacteriophage dilution with 0.3 ml of bacteria and plate with top agar. The next day you count your plaques. You get 46 pfu is the final concentration (pfu/ml) of the phage stock? at this dilution. What

please give anser asap

Please help me do this step by step.

The N-95 mask is considered to be one of the safest masks. It’s pore size is 0.3 um. If that is so, how many covid 19 viral particles (side by side) could fit through one hole at a single time

Σ P UTF-8"Chapter 12 Solutions 202 x 02-xythos.content.blackboardcdn.com/5b19550bob538/10621560?X-Blackboard-Expiration3=D1649052000 DWorksheet.docx Edits will not be automatically saved. aved changes MOu a Garamond 14. B. 三: 三 山 8. When placed in each of the following, indicate if a red blood cell will 1) not change 2) hemolyze 3) crenate 5%(m/v) glucose solution 1%(m/v) glucose solution 0.5%(m/v) NaCl solution 2%(m/v) NaCl solution

Following is the data and notice that it is a terrible idea to culture hMSCs longer than 10 days. You’re strongly Days # cells0 50001 75002 125003 125004 218005 287006 530007 1143008 1653009 19200010 19200011 11680012 8950013 8830014 78300 Part1 You are working for a start-up that is pursuing a clinical trial. The trial involves grafting hMSCs intopatients suffering from interveterbral disc disease using a degradable polymer scaffold. You are going to 3Dprint a porous cylindrical scaffold that is 2 cm in radius and 1 cm in height (matching the dimensions of adegenerated disc). Assume a porosity of 50%. You will fill available volume of the scaffold with hMSCs at adensity of 1 million cells per cm3. Based on the data above, what starting number of cells will you use andhow long will it take you to get enough cells for the trial? Part2The trial is a failure (patients did not report any reduction in back pain). Your team wants to try againusing 85% hMSCs and 15% nucleus pulposus cells .…

Determine the titre of the undiluted phage. 245 Counted plaques. We plated 100 micro Liters (1/10th) of a 10^-8 dilution.

Please help a bit confused

Are the bands indicated in Step 6 (SDS-PAGE) likely visualized by western blot or by a general protein stain (such as Coomassie or silver)?

add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…