5' сТА АG-OC T G ATT сGA 3' 1 3' DNA contains oxidized guanine (G-O) as a result of oxidation damage. 5' 5' ČÍÁ Á G ATT сGA 3' 3 Glycosylase removes the oxidized nucleobase from the 5' sugar-phosphate backbone. 2 ст Cut 5' сТА А ст G ATT сGA 3' 3' At the site of the missing nucleobase, an enzyme cuts the 5' sugar-phosphate backbone. 5' 3' DNA polymerase degrades a short stretch of the strand. 5' ст G ATT сGA 3' 5' 3' The combined actions of DNA сТА А Gст G ATT сGA 3' polymerase and DNA ligase 1 5' fill in and seal the gap. FIGURE 8.11 Repair of Oxidized Guanine in

5' сТА АG-OC T G ATT сGA 3' 1 3' DNA contains oxidized guanine (G-O) as a result of oxidation damage. 5' 5' ČÍÁ Á G ATT сGA 3' 3 Glycosylase removes the oxidized nucleobase from the 5' sugar-phosphate backbone. 2 ст Cut 5' сТА А ст G ATT сGA 3' 3' At the site of the missing nucleobase, an enzyme cuts the 5' sugar-phosphate backbone. 5' 3' DNA polymerase degrades a short stretch of the strand. 5' ст G ATT сGA 3' 5' 3' The combined actions of DNA сТА А Gст G ATT сGA 3' polymerase and DNA ligase 1 5' fill in and seal the gap. FIGURE 8.11 Repair of Oxidized Guanine in

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter26: Synthesis And Degradation Of Nucleotides

Section: Chapter Questions

Problem 6P: Allosteric Regulation of Ribonucleotide Reductase by ATP and Deoxynucleotides Describe the...

See similar textbooks

Similar questions

Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Asap
The enzyme cytidine deaminase catalyzes the conversion of cytidine to uridine. Cytidine deaminase catalyzes the reaction through an addition of water across the cytidine 3,4-bond, forming a tetrahedral intermediate followed by the elimination of NH3 to form the product uridine. This is like the addition-elimination mechanism that we studied for adenosine deaminase. Cytidine deaminase НО. NH₂ N пOH OH cytosine R + H₂O cytidine The Km value for the substrate cytidine is 2.5 × 10-4 M, and the K; for competitive inhibition by the product uridine is 2.5 × 10-³ M. N R A reduced derivative of the product, 3,4,5,6-tetrahydrouridine was shown to be a fully reversible competitive inhibitor with a Ki of 2.4 x 10-7 M, a value approximately 10,000 times lower than that of the product uridine. NH₂ NH uridine HO. N R R = D-ribose HOH OH uridine 3NH uracil ring numbering H NH H H + NH3 H OH H 3,4,5,6-tetra- hydrouridine a.) Draw a structure of the intermediate that we predict to form during the…
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
AU Py U AGGC C UGGC G GG C Jc What modified nucleoside base is indicated by the arrow? dihydrouracil pseudouracil -ACC.
The following amino acids that are often found inside globulin molecules are () A, Tyr B, Phe C, Asn D, Glu True of false 1. In the de novo synthesis of purine nucleotides and pyrimidine nucleotides, base rings are first synthesized and then corresponding nucleotides are formed with phosphoribose. () 2. Transcription is the process of transferring genetic information from DNA to RNA. DNA is synthesized under the catalysis of RNA polymerase, and the direction of synthesis is from the 5 'end to the 3' end. () 3. The change of protein conformation is caused by the breaking of covalent bonds within the molecule. () 4. In very high and very low pH solutions, amino acids exist mainly in non-ionic form. () 5. The active center of an enzyme usually consists of several amino acid residues adjacent to each other in the primary structure. ()
The intermediates A, B, C, D, E, and F all occur inthe same biochemical pathway. G is the product of thepathway, and mutants 1 through 7 are all G−, meaningthat they cannot produce substance G. The followingtable shows which intermediates will promote growthin each of the mutants. Arrange the intermediates inorder of their occurrence in the pathway, and indicatethe step in the pathway at which each mutant strain isblocked. A + in the table indicates that the strain willgrow if given that substance, an O means lack of growth.SupplementsMutant A B C D E F G1 + + + + + O +2 O O O O O O +3 O + + O + O +4 O + O O + O +5 + + + O + O +6 + + + + + + +7 O O O O + O +
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
A Leu →Ala mutation at a site buried in the core of the enzyme lysozymeis found to be destabilizing. Explain the observed effect of this mutationon lysozyme stability by predicting how enthalpy (ΔH°), conformationalentropy (ΔS°peptide), and the hydrophobic effect (ΔS°solvent) are expected to change for the mutant compared to wild-type lysozyme. Explain how ΔG°for unfolding is affected by your predicted changes in enthalpy or entropy.
A chain NH3 NH3 B chain Gly Phe 2. The protein pictured below is bovine insulin. Determine the number and the size of the fragments that would be generated upon treatment with the following: İle Val Val Asn Gln Gln 5 Ġln 5 His look for the cleavage points (a) without DTT and (b) with DTT. Cys Leu Cys S-S Cys Without DTT With DTT Ala Ģly Ser Ser Trypsin 10 Val 10 His Cys Leu Chymotrypsin Ser Val Leu Glu BrCN Tyr Ala 15 Gln 15 Leu Leu Тyr Ġlu Leu Ásn Val Тyr Cys 20 Çys 20 Gly Asn Glu Arg Reagent (source) Trypsin (bovine pancrease) Chymotrypsin (bovine pancrease) Staphylococcus V8 protease Pepsin (porcine pancrease) Cyanogen bromide (chemical)(CnBr) Specificity Lys, Arg (C) Phe, Trp, Tyr (C) Glu, Asp (C) Phe, Trp, Tyr (N) Met (C) Gly Phe 25 Phe Тyr Thr Pro Lys 30 Ála
For each of the following mutant E. coli strains,plot a 30-minute time course of concentration ofβ-galactosidase, permease, and acetylase enzymesgrown under the following conditions: For the first10 minutes, no lactose is present; at 10 minutes, lactosebecomes the sole carbon source. Plot concentration onthe y-axis, time on the x-axis. (Don’t worry about theexact units for each protein on the y-axis.)a. I− P+ o+ Z+ Y+ A+ / I+ P+ o+ Z− Y+ A+b. I− P+ ocZ+ Y+ A− / I+ P+ o+ Z− Y+ A+c. IsP+ o+ Z+ Y+ A+ / I− P+ o+ Z− Y+ A+d. I− P− o+ Z+ Y+ A+ / I− P+ ocZ+ Y− A+e. I− P+ o+ Z− Y+ A+ / I− P− ocZ+ Y− A+
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.