5' GTATGTTACGTAACCTCTGCCTGCTAAGGGTAGAATATAGCTACGCTATCGATGGTAGCTAGCGATCG 3' a b с 29) Examine the sequence and identify the TFIID binding site (not one of the shaded regions). What is it?
Q: Compare a Male Baboon to a Male Human. Compare the Articulated Foot, the Coccyx/Sacrum/Os Coxae, and…
A: The objective of this question is to compare the anatomical structures of a male baboon and a male…
Q: Male bullfrogs fighting for access to females for mating purposes is an example of: O Exploitation…
A: Competition is a type of negative interaction which occurs, when two organisms compete for the same…
Q: For a lab on diffusion and osmosis, where a egg yolk was placed in a cup water the following…
A: The movement of water inside an egg yolk is influenced by the principles of osmosis. Osmosis is the…
Q: In the tomato the mutant genes o (oblate = flattened fruit), p (peach = hairy fruit), and s…
A: Genetic linkage is the tendency of DNA sequences that are close together on a chromosome to be…
Q: QUESTION 31 Given the absorbance measurements below, use the Abs values below to determine the…
A: 1. Nucleic acids like DNA and RNA are polymers of nucleotides. Each nucleotide is composed of a…
Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…
A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…
Q: Sordaria fimicola is often used to demonstrate arrangement of colored ascospores within an ascus…
A: Sordaria fumicola is an ascomycetes fungus that is used to study the crossing over and recombination…
Q: Part 1: Make a three part process drawing (like a cartoon strip) to demonstrate Mendel's Principle…
A: An allele is a variant form of a given gene. Phenotype is the observed physical traits of an…
Q: Match the tissue shown with its function. option: 1. Present in bone marrow, spleen, and lymph…
A: Tissues are historically derived biological term organizing level in biology that lies between…
Q: For the following sets of partial diploid bacteria, how do I fill out this table? I am not sure how…
A: The method of identifying bacteria frequently includes observing their behavior beneath diverse…
Q: Carrier proteins that bind to substances to move them through the membrane and proteins that form…
A: Proteins are one of the integral groups of biomolecules. They have diverse functions such as…
Q: Sedimentation rates are measured in Svedberg units (S = 10-13 s). Which of the following factors…
A: The standard unit of measurement for sedimentation rates is Svedberg units (S), which is a time unit…
Q: After digesting the DNA produced by PCR (generated using the primers mentioned in question 2 added…
A: DNA (deoxyribonucleic acid) is a molecule that contains the genetic instructions for building and…
Q: he LD50 of a certain substance is appreciably higher by inhalation than by ingestion. What…
A: The LD50 (lethal dose for 50% of the population) of a substance being significantly higher by…
Q: Describe the process by which an integral membrane glycoprotein goes from mRNA to being an integral…
A: Protein synthesis is a very coordinates and complex process involving multi steps. It involves…
Q: Identify this tissue. Select one: a. Epithelial, simple, squamous b. Epithelial, simple, cuboidal…
A: Epithelium is the outer thin layer of tissue made up of continuous layers of cells that lines the…
Q: The following is correct regarding the oxidoreductase enzymes: A. NADH + H+/NAD+ are involved in…
A: Enzymes are chemical substances that serve as biocatalysts to increase the rate of a chemical…
Q: Classify each example as requiring either diffusion or bulk flow as a mechanism for molecular…
A: The transfer of any material from one location to another is referred to as transportation. In the…
Q: For this experiment, you will be able to manipulate only one variable. First, the amount of water;…
A: The method of scientific inquiry regularly includes the plan and execution of experiments. In this…
Q: Compare animal vs. plant proteins in terms of bioavailability, amino acid profile, and effects on…
A: Proteins are essential nutrients for the growth and repair of the body. Proteins can be categorised…
Q: Which of these accounts for the similarity between the P wave duration and the QRS complex duration…
A: This question dives into the complexities of cardiac physiology, particularly centering on the…
Q: Sickle cell disease— what is the background of this disorder: include the name of the disorder, any…
A: Sickle cell disease is a genetic condition characterized by abnormal hemoglobin in red blood cells.
Q: Nitrogen fixation is a difficult process because nitrogen exists in the atmosphere primarily as its…
A: The objective of the question is to understand why nitrogen fixation is a difficult process.…
Q: a. Phylogenetic relationships based on chloroplast genes Brown algae Diatoms Most photosynthetic…
A: Chloroplast is an organelle which is responsible for photosynthesis. It was acquired by a bigger…
Q: Which of the statements regarding plasmodesmata is true? They are channels, located in the plasma…
A: Plasmodesmata are microscopic openings found in plants cells. They help in connecting two adjacent…
Q: For this assessment you are required to write an empirical research report about gratitude and…
A: The objective of this question is to write a research report on the topic of gratitude and…
Q: Cystic fibrosis is a homozygous recessive condition that affects 1 in 10,000 of the Hispanic…
A: The illness known as cystic fibrosis harms your digestive system, lungs, and other organs. It is a…
Q: . Order the events relative to one another based on when each occurred in the fossil record. Earlier
A: Imagine we're flipping through the pages of Earth's history book. First, we stumble upon the chapter…
Q: ansport in mitochondria all olysis ase in the brain
A: All the statements talk about different kinds of inhibitors. Inhibitors are the substances in the…
Q: 6. Provide three primary categories of sources of outdoor air pollution.
A: The objective of the question is to identify the three primary categories of sources that contribute…
Q: order to determine the existence and relevance of common mycorrhizal networks in nature, what…
A: Mycorrhiza is a kind of symbiotic relationship between roots of fire plants and fungi. Symbiotic…
Q: Discuss the Respiratory muscles
A: Respiratory muscles are responsible for the mechanical aspects of breathing, facilitating the…
Q: The pixels in the so-called "Retina" displays are located at a distance shorter than that between…
A: One should be familiar with both the average distance between photoreceptor cells in the human eye,…
Q: 1- The following Wild Type DNA codes for color in a lizard living in the Namib Desert (tan sand) a…
A: In the unique ecological setting of the Namib Desert, the interplay between an organism's physical…
Q: Chimeric antigen receptor T cells (CAR-T cells) are generated as an in vivo gene therapy. A-True…
A: Chimeric Antigen Receptor T-cell therapy is an innovative immunotherapy that has shown promising…
Q: 3 is supposed to have cn in the middle can you help
A: Genetic incidences are the prominent source for eventual gene linkages. To determine if the genes…
Q: When the absolute threshold is reached, _______________________ allowing a rapid influx of…
A: Every cell membrane is polarized meaning that a certain potential or charge difference occurs…
Q: 1) Summarize the main point of the study in two or three sentences. (Make sure you use your own…
A: Summery of the paper:In this study the authors wanted to test the evolution of the the plant…
Q: A pharmacy's stock includes lisinopril 20 mg tablets from one manufacturer with the NDC…
A: NDC, or National Drug Code, numbers are unique identifiers for medications, including prescription…
Q: Discuss the parts of the digestive system of vertebrate and their functions
A: This question is asking about the different parts of the vertebrate digestive framework and their…
Q: Explain in detail the following teratogens: Listeria, the Zika virus and lead in the water supplies.…
A: Teratogens are things that can hurt a baby's development and cause issues when they are developing…
Q: In the graph below, a drug that was inhibitory would cause Membrane potential (mV) +40- 0- -40- -60-…
A: In the graph, you provided, a drug that was inhibitory would cause the membrane potential to be more…
Q: Which of these will you expect to find in a patient with congestive cardiac failure and fluid…
A: This question dives into the physiological changes that happen within the body in reaction to…
Q: Please help me with questions 1 through 3. I greatly appreciate it and thank you very much! 1.…
A: The objective of the first question is to identify four keywords that would be useful in a search…
Q: For your chosen condition, describe the physical changes or damage that has occurred . inside the…
A: This question needs to know what happens to the circulatory framework when it gets harmed or harmed…
Q: Identify this tissue. Select one: a. Epithelial, simple, squamous b. Epithelial, simple, cuboidal…
A: Tissue refers to a group of cells that are similar in structure and work together to perform a…
Q: Not all bones are suitable for bioarchaeological analyses, rendering age and sex estimations…
A: The objective of the question is to understand the factors that might influence the suitability of…
Q: Give three examples of energy sources used by chemolithotrophs?
A: Two categories of organisms can be distinguished based on how they produce food. Heterotrophs…
Q: It is important that a cell checks itself as it moves through the cell cycle. For instance, if…
A: The cell cycle is a meticulously orchestrated process that ensures the healthy replication of cells.…
Q: Which of these is least likely to promote renin secretion by the juxtaglomerular cells? Group of…
A: This question digs into the complex mechanisms that direct renin secretion by the juxtaglomerular…
Biology
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
- using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I first attempted this question I identified the open reading frame as starting from ATG. However I was told that my reading frame was wrong and that the frame should include an asparagine group but how it that possible?Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
- KIF1A has only a single motor domain. What additional structural elements would you expect to find in the KIF1A structure?Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of making a perfect protein of 100 residues.(b) Repeat for a 1000-residue protein.
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′